CaltechAUTHORS
  A Caltech Library Service

Two Drosophila melanogaster tRNAGly genes are contained in a direct duplication at chromosomal locus 56F

Hershey, N. Davis and Davidson, Norman (1980) Two Drosophila melanogaster tRNAGly genes are contained in a direct duplication at chromosomal locus 56F. Nucleic Acids Research, 8 (21). pp. 4899-4910. ISSN 0305-1048. http://resolver.caltech.edu/CaltechAUTHORS:HERnar80

[img]
Preview
PDF
See Usage Policy.

1267Kb

Use this Persistent URL to link to this item: http://resolver.caltech.edu/CaltechAUTHORS:HERnar80

Abstract

One Drosophila melanogaster tRNAGly gene occurs on each 1.1 – 2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.


Item Type:Article
Additional Information:Copyright © 1980 Oxford University Press. Received 3 September 1980. We thank our collaborators, R. Robinson and P. Yen, for their participation in the construction of the DT library and isolation of λDmt56-6 and for numerous discussions about all aspects of this project. This work was supported by a grant from the NIH. Department of Chemistry Contribution Number 6300.
Record Number:CaltechAUTHORS:HERnar80
Persistent URL:http://resolver.caltech.edu/CaltechAUTHORS:HERnar80
Alternative URL:http://nar.oxfordjournals.org/cgi/content/abstract/8/21/4899
Usage Policy:No commercial reproduction, distribution, display or performance rights in this work are provided.
ID Code:4064
Collection:CaltechAUTHORS
Deposited By: Tony Diaz
Deposited On:26 Jul 2006
Last Modified:26 Dec 2012 08:57

Repository Staff Only: item control page