cMyc regulates the size of the premigratory neural crest stem cell pool

cMyc regulates the size of the premigratory neural crest stem

cell pool

Laura Kerosuo

and

Marianne E. Bronner

Division of Biology and Biological Engineering, California Institute of Technology, Pasadena CA

91125

Summary

The neural crest is a transient embryonic population that originates within the central nervous

system, then migrates into the periphery and differentiates into multiple cell types. The

mechanisms that govern neural crest stem-like characteristics and self-renewal ability are poorly

understood. Here, we show that the proto-oncogene cMyc is a critical factor in the chick dorsal

neural tube, where it regulates the size of the premigratory neural crest stem cell pool. Loss of

cMyc dramatically decreases the number of emigrating neural crest cells due to reduced self-

renewal capacity, increased cell death and shorter duration of the emigration process. Interestingly,

rather than via E-Box binding, cMyc acts in the dorsal neural tube by interacting with another

transcription factor, Miz1, to promote self-renewal. The finding that cMyc operates in a non-

canonical manner in the premigratory neural crest highlights the importance of examining its role

at specific timepoints and in an

in vivo

context.

cMyc is a key regulator of the size of the neural crest stem cell pool

Our data suggest that cMyc binds to Miz1 to form a repressive complex that keeps factors such as

Cyclin Dependent Kinase Inhibitors (CDKI) sufficiently low for adequate cell cycle progression

and cell survival to take place in the self-renewing cells. The production of neural crest is

regulated by: 1) the numbers of the neural crest cells generated in the dorsal neural tube and 2) the

length of the emigration period as the newly produced neural crest cells delaminate and initiate

migration towards multiple destinations in the developing embryo.

Corresponding and Lead Contact author: Marianne Bronner, mbronner@caltech.edu.

Author contributions

L.K. and M.E.B conceived and designed the experimental approach. L.K. performed the experiments and analyzed the data. L.K. and

M.E.B. wrote the manuscript.

HHS Public Access

Author manuscript

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Published in final edited form as:

Cell Rep

. 2016 December 06; 17(10): 2648–2659. doi:10.1016/j.celrep.2016.11.025.

Author Manuscript

Introduction

Neural crest cells are multipotent cells that give rise to tens of different cell types in

vertebrate embryos, ranging from craniofacial cartilage and bone to peripheral ganglia and

melanocytes of the skin (

Dupin and Coelho-Aguiar, 2013

). Premigratory neural crest cells

start as neuroepithelial cells in the dorsal neural tube that subsequently undergo an epithelial

to mesenchymal transition (EMT), migrating from their site of origin in the central nervous

system to diverse destinations within the developing embryo (

Kerosuo and Bronner-Fraser,

2012

). The premigratory phase lasts about 24 hours in the bird embryo. Due to its transient

nature, the process of neural crest production must be tightly regulated. However, little is

known about what regulates the size of the neural crest stem cell pool and/or whether it is

comparable to other stem cell niches. Therefore, despite the high clinical relevance and need

to understand how neural crest ‘stemness’ is maintained, the

in vivo

mechanisms that control

the numbers of neural crest precursors and duration of their emigration process are poorly

understood.

The transcription factor and proto-oncogene cMyc has been implicated in a broad range of

cellular functions (

Eilers and Eisenman, 2008

), including cell proliferation and apoptosis. It

has been estimated to regulate 15% of the genome, and has an established role in stem cell

maintenance in both embryonic stem cells and tissue specific stem cell niches in adults and

in the embryo (

Chappell and Dalton, 2013

;

Dong et al., 2011

;

Kerosuo et al., 2008

;

Kwan et

al., 2015

;

Varlakhanova et al., 2010

;

Wilson et al., 2004

). Myc is often dysregulated in

cancer cells, correlating with poor prognosis in many neural crest derived tumors such as

neuroblastoma (

Fredlund et al., 2008

) and melanoma (

Bosserhoff, 2006

). In the chick, the

Myc paralogs,

cMyc

and

nMyc

, exhibit complementary expression patterns during neural

crest development with

nMyc

expressed early in the neural plate and its border and later in

the middle and ventral neural tube (

Khudyakov and Bronner-Fraser, 2009

); in contrast,

cMyc

is expressed in premigratory neural crest cells within the dorsal neural tube. In the

frog, the expression of these paralogs is switched such that

cMyc

is expressed early in the

neural plate border, where it is required for induction of neural crest fate; loss of cMyc

reverts cells to a neural fate, without affecting proliferation or cell death of the stem cell pool

(

Bellmeyer et al., 2003

). In zebrafish,

hMyc,

which is genetically closer to

nMyc

than

cMyc

is expressed in the neural plate during neural crest specification and its knockdown affects

Kerosuo and Bronner

Page 2

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

both neural induction and proper development of neural crest derived tissues such as the

pharyngeal arches (

Hong et al., 2008

). Similarly, conditional knockdown of

cMyc

in mice

using Wnt1-Cre results in defects in formation of pigment, skull and ear (

Wei et al., 2007

Reprogramming of murine radial glial cells with

Brn2

and

cMyc

induces characteristics of

early neural crest cells (

Bung et al., 2015

). Finally, overexpression of avian

nMyc

after EMT

in migratory neural crest cells results in differentiation of neurons at the expense of other

neural crest derivatives (

Wakamatsu et al., 1997

). However, the relative roles of

nMyc

and

cMyc

in the early neural crest remain unclear.

Here, we tackle the role of the multifunctional protein cMyc (

Eilers and Eisenman, 2008

) in

the premigratory neural crest of avian embryos. Initiation of

cMyc

expression begins

concomitant with the onset of EMT, consistent with its proposed role as a late neural crest

specifier gene (

Sauka-Spengler and Bronner-Fraser, 2008

). Moreover, we find that cMyc

plays a critical role in regulating the size of the premigratory neural crest cell pool by

promoting self-renewal and survival. This role is different than its canonical role in

activating transcription together with its binding partner Max via E-Box binding. Instead,

our results show that in the premigratory neural crest, cMyc/Max function depends upon

interaction with another transcription factor Miz-1 to form a repressive complex. Our results

suggest that the Myc/Miz1 complex transcriptionally regulates levels of factors including

cyclin dependent kinase inhibitors, thus enabling cell cycle progression required for self-

renewal. Although cMyc is well-known for its ability to induce proliferation, this does not

appear to be the case in the neural crest, highlighting its tissue-specific roles. These results

provide novel insights into the mechanisms that regulate self-renewal ability in the

premigratory neural crest stem cell pool.

RESULTS

Given the existence of notable species specific differences in expression of

cMyc

in the early

ectoderm, we performed a careful analysis of the expression pattern in the chick embryo by

in situ

hybridization (Figs 1 and S1). The results show that, unlike in the frog (

Bellmeyer et

al. 2003

cMyc

expression is absent from the neural plate and neural plate border (Figs 1A–

B, S1A–D) but is first detected in the cranial dorsal neural folds during neural tube closure

at the 5–6 somite stage (Hamburger Hamilton, HH, stage 8+, Fig 1C). The expression

overlaps with Pax7-immunopositive premigratory neural crest cells (Fig 1C

′

). Intense

cMyc

expression is maintained in neural crest cells throughout emigration and migratory stages

(HH stages 9–12, Figs 1E–F S1E–F).

We next examined the effects of cMyc loss of function in the neural crest by electroporating

a translation blocking morpholino onto one side of the embryo at gastrula stages. As an

internal control, a control morpholino was electroporated on the contralateral side of the

same embryo, which was cultured and analyzed the following day (Fig 2A). 1.2mM

morpholino had no effect on the induction of neural crest cells at the neural plate border

prior to the time of initiation of cMyc expression in the neural folds, which also

demonstrates that the morpholino treatment did not cause any non-specific effects (Figs

S2A–C). In contrast, at premigratory stages (HH8+/9−), cMyc knockdown reduced the

numbers of

FoxD3

and Pax7 expressing neural crest cells compared to control embryos. As

Kerosuo and Bronner

Page 3

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

a result, the neural crest cell domain in the tip of the dorsal neural tube was significantly

smaller on the cMyc-morphant side (Fig 2B–D). However, expression of the neural marker

Sox2 was not affected (Fig 2D). The same phenotype persisted throughout the emigration

and migration period (Figs 2E–H) with on average 85% (for stage 8–10 combined) of the

embryos resulting in a decrease in size of the neural crest population on the cMyc

morpholino-treated side compared with 10% in control embryos (Fig 2G). During migratory

stages (stage 9), this resulted in fewer

Sox10

positive neural crest cells on the cMycMO

treated side. In addition, emigration was delayed, such that none of the cMyc morpholino

electroporated cells had delaminated at the time when the first neural crest cells on the

control morpholino side already were migrating (Figs 2E–F). As emigration continued,

neural crest cells migrated further laterally on the control side as viewed in whole embryos.

In contrast, a

Sox10

-negative area was visible adjacent to the midline in cMyc morpholino-

treated embryos. Transverse sections revealed that emigration had ended on the cMyc

morpholino-treated side such that no more neural crest cells were emerging from the dorsal

neural tube. In contrast, production of

Sox10-

positive cells was still observed on the control

side (Figs 2H, h and hh). Higher dosage of the cMycMO (1.5mM and up) resulted in almost

a complete loss in expression of neural crest markers

, FoxD3

and

Sox10

, and caused severe

degradation of the dorsal neural tube (Fig. S2D–G). Because

cMyc

and

nMyc

have non-

overlapping patterns in the neural tube, we analyzed whether cMyc knockdown caused a

compensatory increase in

nMyc

levels in the neural crest cells. However, no changes in

nMyc

expression were observed after loss of cMyc (Fig S2H).

The apparent decrease in size of the neural crest cell pool prompted us to test whether loss of

cMyc affects the ability of the cells to self-renew. To this end, we performed a colony

forming assay using chick crestospheres that we previously showed could be kept

in vitro

primary epithelial neural crest stem cells (

Kerosuo et al., 2015

) and thus maintained high

expression levels of

cMyc

similar to that of premigratory neural crest cells (Figs 3A,B).

After

cMyc

knockdown achieved by using two different siRNAs, we found that the self-

renewal capacity was reduced by half (Fig. 3C) after a ~ 30–40% decrease in

cMyc

expression levels assayed by QPCR (Fig. 3D). In addition, many of the newly formed cMyc

deficient spheres were smaller in size (~15 cells/sphere as compared to ~30–50 cells on

average in untreated spheres). The capacity of secondary sphere formation was also reduced

after

cMyc

knockdown, further demonstrating an effect on self-renewal rather than

proliferation (Fig. 3E).

We also examined the differentiation capacity of cMyc morpholino-treated neural tube

explants. After a week of

in vitro

differentiation, we detected several types of neural crest

derivatives similar to those seen in control cultures (not shown, n=12 embryos), as indicated

by staining of neurons with Tuj1 antibody, melanoblasts by Mitf protein expression, smooth

muscle cells by SMA antibody and glial cells with BLBP antibody (Figs 3F–G).

Since cMyc is known for its role in cell proliferation and survival (

Eilers and Eisenman,

2008

), we examined whether cell proliferation and/or survival were affected after cMyc

morpholino knockdown. The results show that the proliferation rate in the neural crest was

not changed in a statistically significant manner, though we did detect a slight decrease in

the numbers of proliferating cells by using Phospho-Histone 3 staining (Figs 4A,S3A).

Kerosuo and Bronner

Page 4

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

Instead, we consistently detected fewer cells in the dorsal neural tube (Fig 4B). The tip of

the neural tube also appeared thinner and improperly folded on the cMyc morpholino-treated

side (Figs 4D,F). Since proliferation was not noticeably affected and higher cMycMO

concentrations caused degradation of the dorsal neural tube (Fig S2), we next examined

whether lack of cMyc caused apoptosis in late stage 8 neural folds examined by Caspase3

immunostaining. As compared to the control morpholino injected side, cMycMO increased

apoptosis 4 fold (Figs 4C,E).

To gain insight into possible downstream effectors of cMyc, we performed QPCR to

examine changes in expression of known cMyc targets associated with proliferation and cell

survival (Fig 4G). Surprisingly, neither the cell cycle activator

CyclinE

or the anti-apoptotic

marker

BCL2

were affected by the loss of cMyc as compared to the contralateral side treated

with control morpholino. Expression values were similar to control embryos treated with

control morpholino on both sides. However, in the same embryos, neural crest markers

FoxD3

and

Sox10

were significantly decreased on the cMyc morpholino treated side,

consistent with loss of neural crest cells whereas control embryos had no phenotype.

Interestingly, we also noted upregulation of

p27

on the cMycMO treated side (Fig 4G), a

Cyclin Dependent Kinase Inhibitor (CDKI) associated with cMyc activity (

Yang et al.,

2001

). In light of this, we analyzed the expression of

p27

in wild type embryos. The results

reveal

p27

transcripts throughout the neural tube, albeit with much reduced expression in the

premigratory and early migrating neural crest cells (Fig S3B).

To gain mechanistic insight, we repeated these experiments in the crestospheres. Similar to

the embryo, the results show that proliferation was unaffected in crestospheres by loss of

cMyc (Fig. 4H–I). However, unlike the situation in the embryo, cMyc knockdown in

crestospheres did not trigger apoptosis, suggesting that the cell death in the embryo may be a

secondary consequence of loss of self-renewal ability in vivo. Despite the rather low

transfection efficiency in crestospheres (~30%), we also detected a significant increase in the

levels of p27 transcript expression (Fig. 4K).

The QPCR results raised the possibility that, in the neural crest, cMyc did not affect known

“canonical” downstream targets whereby cMyc with its binding partner Max activates

transcription via E-Box binding. In search of an alternative mechanism for the role of cMyc

in cell self-renewal and survival, we investigated the possible involvement of Miz1, a

transcription factor that works as a transcriptional repressor when bound to cMyc/Max.

Miz1/Myc targets include CDKIs (

Adhikary and Eilers, 2005

). Moreover, we previously

found that

Miz1

is required for proper induction of neural crest cells at the neural plate

border (Fig. 5A;

Kerosuo and Bronner, 2014

Based on the elevated levels of p27 after loss of cMyc, we hypothesized that cMyc may bind

to Miz1 in the premigratory neural crest to form a repressive complex. To test this

possibility, we performed co-immunoprecipitation

in vivo

of neural tubes at the HH stage 8–

9. The results show that an antibody to a flag-tagged chicken Miz1 expressed in moderate

levels (1μg/μl) precipitates endogenous cMyc, demonstrating that the two transcription

factors indeed form a complex in the neural crest cells at the correct stage (Fig 5B).

Kerosuo and Bronner

Page 5

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

To examine the importance of the Miz1/cMyc interaction, we tested the ability of either full

length cMyc (FL cMyc) or cMyc with a single point mutation that renders it incapable of

binding to Miz1 (V394DMyc,

Herold et al.; 2002

) to rescue the loss of cMyc phenotype. To

this end, we simultaneously knocked down cMyc in the premigratory neural crest cells

vivo

and added back either full length human cMyc or the mutated V394D version that is

unable to bind to Miz1 (Fig 5C). Using the human version of the protein has the additional

advantage of being unaffected by the morpholino. Moreover, there is high conservation of

the Myc binding domains (

Peukert et al., 1997

) between human and chicken Miz1 proteins

(Fig S3C). We used Western Blots (WB) to verify efficient expression of the human

constructs in the HH stage 9 embryos after electroporation at gastrula stages (Fig 5D). As

confirmation of the specificity of the morpholino, FL cMyc was able to rescue the

morpholino knock-down phenotype and restore normal levels of

Sox10

expression by QPCR

and

in situ

hybridization (Figs 5E,F). In contrast, the mutated V394DMyc that is unable to

bind to Miz1 was unable to rescue the cMyc loss-of-function phenotype (Figs 5E,G).

Furthermore, we used a Fucci construct to analyze possible differences in the cell cycle

phases and indeed detected more cells arrested in G1 phase on the cMyc morphant side, thus

further supporting the involvement of Myc/Miz1 in cell cycle progression and self-renewal

(Figs. 5H–I).

Next, we asked whether overexpression of cMyc in the premigratory/early migrating neural

crest cells affects neural crest development. We found that overexpression (2 μg/μl) of FL

cMyc caused an increase in neural crest cell production, yielding more premigratory neural

crest cells and a prolonged emigration time (Figs. 6A,C–E). The cells emigrated prematurely

in ~60% of the embryos (Figs 6A,C), and in roughly half of them, the formation of

Sox10

positive cells also continued in the dorsal neural tube on the cMyc over-expressing side at a

time when

Sox10

positive cells were no longer observed on the control side (Figs. 6D black

arrow and S3D). While this phenotype was predominant, a minority of embryos lacked

neural crest cells (Fig. 6C), perhaps due to variability in levels of expression, as high

expression levels also caused degradation and failure of neural tube closure in the majority

of embryos (Fig S3E). At lower levels (0.5 μg/μl), neural crest cells also emigrated from the

neural tube earlier than on the control side (Fig S3F), similar to effects observed with higher

levels. In contrast to FL cMyc, embryos over-expressing the V394DMyc mutant (2μg/μl)

had no phenotype and only a small percentage (11%) had neural tube closure defects (Figs

6B,C,F and S3D,E). These results suggest that the ability to bind to Miz1 is required for the

effect of cMyc on premigratory neural crest cells.

Finally, we investigated whether overexpression of either FL cMyc or V394DMyc mutant

had an impact on self-renewal, cell proliferation or cell survival in crestospheres. Similar to

observations in the embryo, overexpression of FL cMyc clearly showed a significant

increase in self-renewal capacity with the FL but not V394D Myc. Neither proliferation, as

assayed by PH3 staining, or cell survival were affected. These results suggest that self-

renewal and proliferation may be regulated via different mechanisms.

Kerosuo and Bronner

Page 6

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

DISCUSSION

Neural crest cells are a population of multipotent cells with broad developmental potential

vivo

, exceeded only by the inner cell mass cells of the blastocyst in their ability to contribute

to multiple cell types characteristic of “all three germ layers”. Understanding neural crest

cell function is highly clinically relevant given the large spectrum of neural crest derived

disorders, including craniofacial, cardiovascular, peripheral nervous system and enteric

syndromes. Aggressive cancers like neuroblastoma and melanoma also originate from this

cell population (

Takahashi et al., 2013

). Furthermore, due to its broad range of derivatives,

neural crest stem cells hold great promise for regenerative medicine. Multiple

in vitro

approaches have been used to understand cues required for their development and stem cell

maintenance (

Kerosuo et al., 2015

;

Lee et al., 2010

;

Lee et al., 2007

). Neural crest cells can

be derived from human embryonic stem (ES) cells or postnatal fibroblast cells

in vitro

;

however, these do not resemble premigratory neural crest cells within the neural tube.

Rather, these cultures exhibit various features of late, committed neural crest cells

intermixed with multipotent cells (

Kim YJ, 2014

). Despite the importance of understanding

these initial regulatory events, the regulation of the premigratory neural crest stem cell pool

is poorly understood. To address this question, we have used an

in vivo

approach in the

chick embryo combined with

in vitro

premigratory ‘crestospheres’ (

Kerosuo et al., 2015

Here, we show that cMyc is involved in regulating the size of the premigratory neural crest

stem cell pool as well as the duration of the neural crest cell emigration period. Our results

thus provide new

in vivo

insight into the timing and maintenance of neural crest production.

We show that cMyc is expressed in neural crest cells in the dorsal neural tube at stages

correlating with initiation of EMT (Figs 1 and S1). This contrasts with observations in the

frog where there appears to have been a paralog switch between cMyc and nMyc compared

with the chick. In Xenopus embryos, cMyc is expressed much earlier at the neural plate

border where it appears to play a role in neural crest induction, but not in later in

maintenance of the stem cell pool (

Bellmeyer et al., 2003

). In chick, we find that knockdown

of cMyc using a translation blocking morpholino (cMycMO) results in fewer neural crest

cells and a reduction in neural crest markers,

Sox10, FoxD3

and Pax7. While the expression

levels of these markers in individual cells was unchanged (Fig 2), indicating that neural crest

induction occurred normally, the numbers of neural crest cells appeared decreased.

Importantly, cMyc knockdown resulted in premature cessation of the neural crest cell

production by the dorsal neural tube (Fig 2), likely reflecting a reduced self-renewal

capacity. Conversely, we observed prolonged neural crest production and emigration after

cMyc overexpression (Fig 6). Using a complementary

in vitro

approach of crestospheres

(

Kerosuo et al., 2015

), we noted a reduction in the self-renewal ability of premigratory

neural crest cells due to cMyc knockdown (Fig 3). Reciprocally, self-renewal was increased

upon over-expression of cMyc (Fig 6). This is consistent with the strong connection

previously noted between cMyc and maintenance of self-renewal in several other types of

stem cells (

Chappell and Dalton, 2013

;

Kerosuo et al., 2008

;

Murphy et al., 2005

;

Takahashi

and Yamanaka, 2006

). Loss of cMyc seemed to affect the numbers of the multipotent stem

cells, rather than affecting capacity to maintain a certain lineage, as shown by the fact that

cMyc deficient neural crest cells are still able to form all major types of neural crest

Kerosuo and Bronner

Page 7

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

derivatives (Fig 3). Previous studies point to cMyc’s pivotal role in adhesion related changes

during exit from the hematopoietic and epidermal stem cell niches (

Frye et al., 2003

;

Varlakhanova et al., 2010

;

Waikel et al., 2001

;

Wilson et al., 2004

). Consistent with this, the

timing of cMyc expression correlates with onset of neural crest EMT that is accompanied by

adhesion changes in which Miz1 has been implicated (

Kerosuo and Bronner, 2014

Moreover, in keratinocytes, Miz1 binding is required for these changes (

Gebhardt et al.,

2006

) in line with the results shown here. However, a direct link between cMyc-regulated

self-renewal and cell adhesion changes during neural crest EMT has yet to be established.

We detected an increase in apoptotic cells on the cMyc morpholino-electroporated side,

resulting in a thinner dorsal neural tube. On the other hand, cell proliferation, perhaps

representing the most commonly known function of cMyc, was not significantly altered.

Moreover, levels of known cMyc downstream targets that promote proliferation or cell

survival were unaffected (Fig 4). Therefore, we investigated alternative mechanisms

whereby cMyc might affect target gene expression by interacting with Miz1 or RAREs

(

Adhikary and Eilers, 2005

;

Uribesalgo et al., 2012

). Indeed, we detected upregulated levels

of p27, a cyclin dependent kinase inhibitor that suggested a possible connection with Miz1.

Down-regulation of p27 has been associated previously with cMyc albeit not been linked to

Miz1 (

Yang et al., 2001

;

Zindy et al., 2006

), and highlights the possibility that additional

CDKIs may be involved in maintenance of the neural crest stem cell pool. To test a possible

interaction between cMyc and Miz1, we performed rescue experiments by co-

electroporating cMyc morpholino with either wild type or a mutated version of cMyc

incapable of binding to Miz1. Whereas the former gave efficient rescue, demonstrating the

specificity of the phenotype, the latter was unable to rescue the cMyc deficient phenotype

(Fig 5), consistent with cMyc binding to Miz1 and repressing its activating function.

Moreover, co-immunoprecipitation showed that cMyc and Miz1 indeed bind to one another

in the chick neural tube during premigratory neural crest stages. We also detected an

increase of neural crest cells in G1 cell cycle arrest after loss of cMyc (Fig 5), which we

speculate triggers apoptosis of these cells as shown in Figure 4. Although a similar increase

in apoptosis was not observed in crestospheres (Fig. 4), this may be due to the relatively low

transfection efficiency

in vitro

compared with much higher penetration of morpholino in the

embryo. In addition to being important for maintenance of the stem cell pool shown here,

Miz1 also plays an earlier role in neural crest specification that is independent of cMyc and

occurs prior to expression of the latter (

Kerosuo and Bronner, 2014

). Consistent with these

results, Miz1 is known to form repressive complexes with transcription factors other than

cMyc (

Basu et al., 2009

;

Phan et al., 2005

). Interestingly, overexpression of the mutated

cMycV394D form that is incapable of binding to Miz1 had no effect on neural crest

development or self-renewal (Figs 5 and 6), further strengthening the hypothesis that the

action of cMyc in the premigratory neural crest cells is specific to its interaction with Miz1.

It has been shown that heterogeneous endogenous levels of cMyc expression are key for

creating cell competition for fitness in mouse epiblast cells, resulting in apoptotic

elimination of those cells with lowest cMyc levels (

Claveria et al., 2013

). This phenomenon

also is seen in the

Drosophila

wing after ectopic expression (

Johnston, 2009

) suggesting a

widely utilized mechanism for stem cell niche homeostasis during development. Similarly,

we show that transient knockdown or overexpression of cMyc via electroporation, which

Kerosuo and Bronner

Page 8

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

produces unequal levels of cMyc in neighboring cells, alters the size of the neural crest

precursor pool. Our results implicate cMyc in regulating the overall amount of neural crest

production in the embryo. We show that cMyc acts in the neural crest via binding to Miz1,

thus changing it from an activator to a repressor.

In summary, our results reveal a novel mechanism of self-renewal regulation in the neural

crest population at premigratory stages. This involves a non-canonical function for the proto-

oncoprotein cMyc: despite the fact that cMyc plays a variety of roles in development and

cancer, its primary and perhaps sole function in the premigratory neural crest seems to be in

maintenance of self-renewal. This is distinct from its role at later stages, for example where

cMyc has been show to promote neuronal differentiation in the neural tube

in vivo

(

Zinin et

al., 2014

). The neural crest is often characterized as a transient cell population that emigrates

from the neural tube and differentiates into multiple derivatives. Despite its ephemeral

nature, our results reveal the importance of the self-renewal capability of premigratory cells,

regulated by cMyc/Miz, in determining the size of the neural crest stem cell pool.

Experimental Procedures

In situ hybridization

Embryos were fixed with 4% paraformaldehyde, washed with PBS/0.1% Tween, dehydrated

in MeOH, and stored at −20°C. The avian

cMyc

probe was made by using cEST191o11

(

www.chick.manchester.ac.uk

) and the

Sox10

FoxD3

Dlx-5

and

Sox2

probes were made by

cloning respective genes to DNA vectors from RT-PCR products made by using chicken

whole embryo cDNA as template. Whole-mount

in situ

hybridization was performed as

described (

Acloque et al., 2008

). The digoxigenin-conjugated RNA probes were visualized

by using anti dig-AP antibody (11093274910, Roche Diagnostics GmbH in 1/2000) and

NCB/BCIP (11383213001 and 11383221001, Roche Diagnostics GmbH). Embryos were

sectioned at 12– 18 μm.

Morpholino knockdown and HH4 electroporation of the chicken embryos

FITC-conjugated morpholinos were purchased from Gene Tools LLC (

www.gene-

tools.com

). The cMyc (CTGCGAGACGGAGCGAGGCAATAAT), and Miz-1

(AACTGGGACAGCTGCTGCAAGCCAC) translation blocking morpholinos were targeted

to the respective 5’ UTR in close proximity of the ATG and a control morpholino was

designed to assure lack of non-specific effects from electroporation

(CTGCGATGAAAAACACGGGAGCACA). The MOs were diluted to a 1–2mM

concentration and electroporated together with an empty pGAG vector as carrier DNA (1

l). The morpholino was injected as two-sided injections with control morpholino on the

contralateral side. The electroporation was carried out as previously described (

Sauka-

Spengler T, 2008

). Briefly, the chicken embryos were collected on Whatman filter papers

and electroporated at Hamburger and Hamilton (HH) stage 4 by using 5.3V and 5 pulses

(50mA/100mA) and incubated on individual petri dishes (Falcon 1008 35×10mm) in thin

albumin until they reached the desired stage.

Kerosuo and Bronner

Page 9

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

Q-PCR

mRNA was isolated from stage 8–9 embryos by using the Ambion® RNAqueous-Micro Kit

by individually collecting neural tube halves from the cMycMo treated and the contralateral

CoMo treated sides, respectively. The control embryos were treated with CoMo on both

sides. The results are shown as the relative expression fold of the treated side versus the

control side, or treated crestospheres versus respective controls, and were analyzed using the

ΔΔCT method (

Livak and Schmittgen, 2001

). Results from 3–8 individual embryos were

pooled and are shown as average values. The error bars represent the standard error of mean

(SEM). Primers were designed to target an exon-exon boundary and their amplification rate

was verified as linear within the margin of a +/− 10% amplification rate change between

points in the logarithmically diluted cDNA standard curve. The following primers were

used:

Sox10

fwd AGCCAGCAATTGAGAAGAAGG;

Sox10

rev

GAGGTGCGAAGAGTTGTCC;

FoxD3

fwd TCTGCGAGTTCATCAGCAAC;

FoxD3

rev

TTCACGAAGCAGTCGTTGAG;

cMyc

fwd GCAGCGACTCGGAAGAAGAACAAGAA

cMyc

rev TGCTGGATTCAGACTCGTTCGCTT;

BCL2

Fwd

CGGCAACAGTATGAGGCCTTTGTT

BCL2

rev ATAAGCGCCAAGAGTGATGCAAGC

and

P27

fwd AGCCCGAGACGACATCAAACGTAA;

P27

rev

TTTATATCTTCCTGGCTTCACCGCCC with

GaphdH

fwd1

ATCACTATCTTCCAGGAGCGTG;

GapdH

rev1 AGCACCACCCTTCAGATGAG; as well

CyclinE

fwd TACCGTGCCTGTTTGTCTCTGGAA and

CyclinE

rev

AGAGGCTTTGAAATGTCGCCTTGC with

GapdH

fwd2 CAGAGGACCAGGTTGTCTCC

and

GapdH

rev2 CAGGGTTGCTGTATCCAAAC.

Immunostaining, Western Blot and Immunoprecipitation

The following primary antibodies were used for immunofluorescence: Caspase 3 (1/200,

AF835 R&D Systems) and Pax7 (1/10; Developmental Studies Hybridoma Bank, University

of Iowa), Sox2 (rb), Mitf (1/500, Abcam ab122982), Tuj-1 (1/400, Covance MMS-435P),

SMA (1/1000, Sigma A5228), BLBP (1/200, Millipore ABN14), Cherry (1/150, Clontech

Living colors 632543), Histone H3 Phospho S10 (1/2000, Abcam 14955). Antibodies were

incubated in PBS/0.2% tween, 1% DMSO and 10% goat serum with whole mount embryos

for 2 days in +4°C, or alternatively on 12μm cryosections over night, and by using the

respective secondary antibodies by Alexa (1/1000;

www.bdbiosciences.com

). The cells were

imaged using fluorescence microscopy (Zeiss Axioscope 2 and Zeiss ApoTome.2)

For Western blot, SDS-PAGE was performed by using Bolt

™

4–12% or 8%, respectively,

Bis-Tris Plus gels (NW04120Box, NW0080Box, Invitrogen) with the Novex electrophoresis

chamber system (Life Technologies) followed by a transfer onto the nitrocellulose filter by

using the Criterion Blotter (Bio-Rad). The filters were blocked with 4% milk/PBS-0.2%

Tween for 1h RT and stained with primary Ab O/N +4*C, washed 5x with PBS-0.2% Tween

RT and incubated with the secondary Ab in block 1.5h RT, washed 5x and illuminated by

using ECL

™

(RPN2232 Amersham). The following primary antibodies were used for

Western Blot: Flag (1/4000; M2 F1804 Sigma), cMyc (c-8, 1/50, Santa Cruz SC-41), cMyc

(N262, 1/3000 Santa Cruz SC-764),

-Tubulin (1/10000 Sigma T5168) ribosomal S6

(1/5000 cell Signalling 5G10). The following secondary antibodies were used for Western

Blot: peroxidase labeled Gt anti-Rb IgG (KPL 074-1806, 1/20 000), Gt anti-Ms IgG

Kerosuo and Bronner

Page 10

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

(KPL074-1506; 1/20 000). For the IP, Pre-swollen protein G-agarose beads (Sigma P7700)

were coated with 20 μg of Flag antibody (M2 F1804 Sigma) or Ms IgG1 (Santa Cruz

SC-3877) o/n +4*C, washed and added onto lysed stage 8–9 (5–7 som) chick embryo neural

tubes (from anterior tip up to somite 2-level in 900 μl lysis buffer consisting of 50mM Tris-

HCL pH7.4, 150mM NaCl, 1% NP-40 with Protease Inhibitor Cocktail (Complete EDTA-

free, Roche 11873580001)) and incubated RT*C for 3h. The beads were then washed 6x

with lysis buffer and beads were detached by using 50 μl 8M Urea/2.5% SDS (30min 65*C),

and the supernatant was run on a SDS-Page gel as described above and blotted with the anti-

Myc ab.

Cell survival and proliferation

Cell survival and proliferation were measured by counting the percentage of Caspase3 and

PH3 immunopositive cells on cryosections or z-stack images on whole crestospheres,

respectively, from all Dapi-stained nuclei in the dorsal neural tube at premigratory neural

crest stage. MycMo electroporated side was compared to CoMo side. The results from 10–

20 sections from each embryo were pooled to represent each embryo (n). For the

crestosphere experiments, 2–4 z-stack slices per sphere (at least 5μm apart from each other)

were counted.

Expression constructs

The coding sequence of the human

cMyc

as well as the mutated

cMycV394D

(

Herold et al.,

2002

), a kind gift from Martin Eilers, were subcloned, and the chicken

Miz1

gene was

cloned into the pCIG-RFP chicken expression vector. For

Miz-1

, the 5

′

end was tagged with

a 1x Flag sequence that was inserted into the PCR primers and chicken cDNA was used as a

template (Miz1gallusFwd with Flag/Bstb1

TTTTTCGAAGCCACCATGGACTACAAGGACGACGACGACAAGGCAGCAatggatttccc

ccagcacag, Miz1gallusRev with NheI TTTT GCTAGC ttttacaccgtttccaagca). The G1 cell

cycle arrest was monitored by expression of pRetroX-G1-red (Clontech 631463) by

electroporation (1 μg/μl) together with either cMycMO or CoMO, respectively, the

expression was enhanced by using an anti-Cherry antibody, and the percentage of positive

cells was measured as compared to Dapi-staining on sections as described above.

Self-renewal assay, siRNA transfection and DNA transfection into crestospheres

Self-renewal was measured in crestospheres by counting the ability of single cells to form

new spheres after a week in crestosphere stem cell culture as described in figure 3A

(

Kerosuo et al., 2015

). Accumax (innovative cell technologies) was used (15min RT*C

accompanied with trituration with a p1000 pipette) to dissociate the crestospheres into single

cells. The custom designed siRNA for avian

cMyc

(Ambion, designed to target the

following sequences #1 GCAUCAGAGGAGCACUGUA and #2

GCAGGGUCCUCAAACAGAU) as well as the control (Silencer Select Negative Control

#1, Ambion 4390843) was transfected by using either the HiPerfect (Quiagen 301704) or

Lipofectamine 3000 (L3000008 Invitrogen) kit, respectively, by using 750ng siRNA/200

000 cells incubated for 3 days before performing the colony forming self-renewal assay.

DNA was transfected according to instructions by using the Lipofectamine 3000 (L3000008

Kerosuo and Bronner

Page 11

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

Invitrogen) kit with 1.5μl Lipofectamine and 500ng of DNA per each 24-well plate well, and

the self-renewal assay was performed on day 3 after the transfection.

Explant cultures

Embryos were electroporated at gastrula (HH4) stage with either cMycMo or CoMo on one

side of the embryo and grown on filter papers until they reached premigratory (4–5 som)

stage. Halves of cranial neural tubes were dissected out and placed on fibronectin coated

(5μg/ml in PBS 2h RT) cover glasses and cultured in a DMEM with 1% FBS for 1 week (for

smooth muscle and melanocyte differentiation); or alternatively laminin coated (50μg/ml

30min 37°C), cover glasses with DMEM complemented with N2 supplement (for neural and

glial differentiation), fixed 20min in 4% PFA at RT and immunostained.

Statistical methods

All averages represent the data pooled from at least 3 biological samples (n), either

individual embryos or individually prepared batches of crestospheres. Error bars represent

the standard mean of error (SEM) and the p-values were calculated by using student’s ttest;

* represents <0.05 and **<0.01.

Supplementary Material

Refer to Web version on PubMed Central for supplementary material.

Acknowledgments

This work was funded by NIH grants HD037105 and DE024157 (to M.E.B.) and by fellowships from The Sigrid

Juselius Foundation, Finnish Cultural Foundation, Jane and Aatos Erkko Foundation, Väre Foundation, and Ella

and Georg Ehrnrooth Foundation (to L.K.). We thank Drs. Crystal Rogers, Stephen Green and Michael Piacentino

and the entire Bronner lab members for technical advice.

References

Acloque, H., Wilkinson, DG., Nieto, MA. Chapter 9 In Situ Hybridization Analysis of Chick Embryos

in Whole-Mount and Tissue Sections. In: Marianne, B-F., editor. Methods Cell Biol. Academic

Press; 2008. p. 169-185.

Adhikary S, Eilers M. Transcriptional regulation and transformation by Myc proteins. Nature reviews

Molecular cell biology. 2005; 6:635–645. [PubMed: 16064138]

Basu S, Liu Q, Qiu Y, Dong F. Gfi-1 represses CDKN2B encoding p15INK4B through interaction with

Miz-1. Proc Natl Acad Sci U S A. 2009; 106:1433–1438. [PubMed: 19164764]

Bellmeyer A, Krase J, Lindgren J, LaBonne C. The protooncogene c-myc is an essential regulator of

neural crest formation in xenopus. Dev Cell. 2003; 4:827–839. [PubMed: 12791268]

Bosserhoff AK. Novel biomarkers in malignant melanoma. Clin Chim Acta. 2006; 367:28–35.

[PubMed: 16480699]

Bung R, Worsdorfer P, Thier MC, Vogt K, Gebhardt M, Edenhofer F. Partial dedifferentiation of

murine radial glia type neural stem cells by Brn2 and c-Myc yields early neuroepithelial

progenitors. J Mol Biol. 2015

Chappell J, Dalton S. Roles for MYC in the establishment and maintenance of pluripotency. Cold

Spring Harb Perspect Med. 2013; 3:a014381. [PubMed: 24296349]

Claveria C, Giovinazzo G, Sierra R, Torres M. Myc-driven endogenous cell competition in the early

mammalian embryo. Nature. 2013; 500:39–U53. [PubMed: 23842495]

Kerosuo and Bronner

Page 12

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

Dong J, Sutor S, Jiang G, Cao Y, Asmann YW, Wigle DA. c-Myc regulates self-renewal in

bronchoalveolar stem cells. PLoS One. 2011; 6:e23707. [PubMed: 21858211]

Dupin E, Coelho-Aguiar J. Isolation and differentiation properties of neural crest stem cells.

Cytometry Part A. 2013; 83:38–47.

Eilers M, Eisenman R. Myc’s broad reach. Genes Dev. 2008; 22:2755–2766. [PubMed: 18923074]

Fredlund E, Ringner M, Maris J, Påhlman S. High Myc pathway activity and low stage of neuronal

differentiation associate with poor outcome in neuroblastoma. Proc Natl Acad Sci U S A. 2008;

105:14094–14099. [PubMed: 18780787]

Frye M, Gardner C, Li ER, Arnold I, Watt FM. Evidence that Myc activation depletes the epidermal

stem cell compartment by modulating adhesive interactions with the local microenvironment.

Development. 2003; 130:2793–2808. [PubMed: 12736221]

Gebhardt A, Frye M, Herold S, Benitah S, Braun K, Samans B, Watt F, Elsässer H-P, Eilers M. Myc

regulates keratinocyte adhesion and differentiation via complex formation with Miz1. The Journal

of cell biology. 2006; 172:139–149. [PubMed: 16391002]

Herold S, Wanzel M, Beuger V, Frohme C, Beul D, Hillukkala T, Syvaoja J, Saluz H-P, Haenel F,

Eilers M. Negative regulation of the mammalian UV response by Myc through association with

Miz-1. Mol Cell. 2002; 10:509–521. [PubMed: 12408820]

Hong S-K, Tsang M, Dawid I. The mych gene is required for neural crest survival during zebrafish

development. PLoS ONE. 2008; 3:e2029–e2029. [PubMed: 18446220]

Johnston LA. Competitive interactions between cells: death, growth, and geography. Science. 2009;

324:1679–1682. [PubMed: 19556501]

Kerosuo L, Bronner M. Biphasic influence of Miz1 on neural crest development by regulating cell

survival and apical adhesion complex formation in the developing neural tube. Mol Biol Cell.

2014; 25:347–355. [PubMed: 24307680]

Kerosuo L, Bronner-Fraser M. What is bad in cancer is good in the embryo: importance of EMT in

neural crest development. Semin Cell Dev Biol. 2012; 23:320–332. [PubMed: 22430756]

Kerosuo L, Nie S, Bajpai R, Bronner ME. Crestospheres: Long-Term Maintenance of Multipotent,

Premigratory Neural Crest Stem Cells. Stem Cell Reports. 2015; 5:499–507. [PubMed: 26441305]

Kerosuo L, Piltti K, Fox H, Angers-Loustau A, Häyry V, Eilers M, Sariola H, Wartiovaara K. Myc

increases self-renewal in neural progenitor cells through Miz-1. J Cell Sci. 2008; 121:3941–3950.

[PubMed: 19001505]

Khan FH, Pandian V, Ramraj S, Aravindan S, Herman TS, Aravindan N. Reorganization of

metastamiRs in the evolution of metastatic aggressive neuroblastoma cells. BMC Genomics. 2015;

16:501. [PubMed: 26148557]

Khudyakov J, Bronner-Fraser M. Comprehensive spatiotemporal analysis of early chick neural crest

network genes. Dev Dyn. 2009; 238:716–723. [PubMed: 19235729]

Kim YJ, LH, Li Z, Oh Y, Kovlyagina I, Choi IY, Dong X, Lee G. Generation of Multipotent Induced

Neural Crest by Direct Reprogramming of Human Postnatal Fibroblasts with a Single

Transcription Factor. Cell Stem Cell. 2014; 15:1–10. [PubMed: 24996160]

Kwan KY, Shen J, Corey DP. C-MYC transcriptionally amplifies SOX2 target genes to regulate self-

renewal in multipotent otic progenitor cells. Stem Cell Reports. 2015; 4:47–60. [PubMed:

25497456]

Lee G, Chambers SM, Tomishima MJ, Studer L. Derivation of neural crest cells from human

pluripotent stem cells. Nat Protoc. 2010; 5:688–701. [PubMed: 20360764]

Lee G, Kim H, Elkabetz Y, Al Shamy G, Panagiotakos G, Barberi T, Tabar V, Studer L. Isolation and

directed differentiation of neural crest stem cells derived from human embryonic stem cells. Nat

Biotechnol. 2007; 25:1468–1475. [PubMed: 18037878]

Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR

and the 2(−Delta Delta C(T)) Method. Methods. 2001; 25:402–408. [PubMed: 11846609]

Murphy M, Wilson A, Trumpp A. More than just proliferation: Myc function in stem cells. Trends Cell

Biol. 2005; 15:128–137. [PubMed: 15752976]

Peukert K, Staller P, Schneider A, Carmichael G, Hänel F, Eilers M. An alternative pathway for gene

regulation by Myc. EMBO J. 1997; 16:5672–5686. [PubMed: 9312026]

Kerosuo and Bronner

Page 13

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

Phan R, Saito M, Basso K, Niu H, Dalla Favera R. BCL6 interacts with the transcription factor Miz-1

to suppress the cyclin-dependent kinase inhibitor p21 and cell cycle arrest in germinal center B

cells. Nat Immunol. 2005; 6:1054–1060. [PubMed: 16142238]

Sauka-Spengler T, BM. Gain-and loss-of-function approaches in the chick embryo. Methods Cell Biol.

2008:237–256.

Sauka-Spengler T, Bronner-Fraser M. A gene regulatory network orchestrates neural crest formation.

Nature reviews Molecular cell biology. 2008; 9:557–568. [PubMed: 18523435]

Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult

fibroblast cultures by defined factors. Cell. 2006; 126:663–676. [PubMed: 16904174]

Takahashi Y, Sipp D, Enomoto H. Tissue interactions in neural crest cell development and disease.

Science. 2013; 341:860–863. [PubMed: 23970693]

Uribesalgo I, Benitah SA, Di Croce L. From oncogene to tumor suppressor: the dual role of Myc in

leukemia. Cell Cycle. 2012; 11:1757–1764. [PubMed: 22510570]

Varlakhanova NV, Cotterman RF, deVries WN, Morgan J, Donahue LR, Murray S, Knowles BB,

Knoepfler PS. myc maintains embryonic stem cell pluripotency and self-renewal. Differentiation.

2010; 80:9–19. [PubMed: 20537458]

Waikel RL, Kawachi Y, Waikel PA, Wang XJ, Roop DR. Deregulated expression of c-Myc depletes

epidermal stem cells. Nat Genet. 2001; 28:165–168. [PubMed: 11381265]

Wakamatsu Y, Watanabe Y, Nakamura H, Kondoh H. Regulation of the neural crest cell fate by N-

myc: promotion of ventral migration and neuronal differentiation. Development. 1997; 124:1953–

1962. [PubMed: 9169842]

Wei K, Chen J, Akrami K, Galbraith G, Lopez I, Chen F. Neural crest cell deficiency of c-myc causes

skull and hearing defects. Genesis. 2007; 45:382–390. [PubMed: 17523175]

Wilson A, Murphy MJ, Oskarsson T, Kaloulis K, Bettess MD, Oser GM, Pasche AC, Knabenhans C,

MacDonald HR, Trumpp A. c-Myc controls the balance between hematopoietic stem cell self-

renewal and differentiation. Genes Dev. 2004; 18:2747–2763. [PubMed: 15545632]

Yang W, Shen J, Wu M, Arsura M, FitzGerald M, Suldan Z, Kim DW, Hofmann CS, Pianetti S,

Romieu Mourez R, et al. Repression of transcription of the p27(Kip1) cyclin-dependent kinase

inhibitor gene by c-Myc. Oncogene. 2001; 20:1688–1702. [PubMed: 11313917]

Zindy F, Knoepfler PS, Xie S, Sherr CJ, Eisenman RN, Roussel MF. N-Myc and the cyclin-dependent

kinase inhibitors p18Ink4c and p27Kip1 coordinately regulate cerebellar development. Proc Natl

Acad Sci U S A. 2006; 103:11579–11583. [PubMed: 16864777]

Zinin N, Adameyko I, Wilhelm M, Fritz N, Uhlen P, Ernfors P, Henriksson MA. MYC proteins

promote neuronal differentiation by controlling the mode of progenitor cell division. Embo Rep.

2014; 15:383–391. [PubMed: 24599748]

Kerosuo and Bronner

Page 14

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

Figure 1. Onset Of

cMyc

Expression In The Premigratory Neural Crest

(A–D)

In situ

hybridization shows that

cMyc

expression initiates in the premigratory cranial

neural crest within the dorsal neural tube at Hamburger Hamilton (HH) stage 8 prior to EMT

and remains on during emigration from the neural tube at stage 9.

′

)

cMyc

expression

overlaps with that of the neural crest marker Pax7, observed in a transverse section by

immunostaining.

(E–F, E

′

)

cMyc

expression persists in neural crest cells throughout

migration. Scale bar for whole embryos 150 μm; sections 20μm. See also figure S1.

Kerosuo and Bronner

Page 15

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

Figure 2. cMyc Regulates The Size Of The Neural Crest Stem Cell Pool

(A)

Translation blocking cMyc morpholino was electroporated into gastrula stage (HH stage

4) embryos on one side, while the contralateral side was injected with control morpholino as

an internal control and analyzed the next day.

(B–C)

cMyc knockdown reduces the numbers

of premigratory neural crest cells in the dorsal neural tube as shown by

in situ

hybridization

for

FoxD3

whereas control embryos show similar levels of

FoxD3

expression on both sides.

(D)

The size of the neural crest cell domain is smaller as shown by Pax7 immunostaining but

Sox2 protein levels are similar on both sides (n=9/9 for Sox2/Pax7 immunos).

(E)

At HH

stage 9, fewer

Sox10

-positive neural crest cells (black arrow) are noted on the cMyc

morphant side and their emigration has not yet started whereas neural crest cells have

emigrated on the control side (blue arrow);

(F)

control embryos are similar on both sides.

(G)

85% of embryos have a reduced number of neural crest cells and thus a smaller neural

crest stem cell pool on the cMyc morphant side compared with only 10% of control embryos

(n=58 for stage 8–10 combined, n=20 for control embryos).

(H)

The phenotype persists

during the migration phase: emigration starts later and ends sooner on the cMyc morphant

side leaving a

Sox10

-negative region next to the midline (magnified in

and marked by

Kerosuo and Bronner

Page 16

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

black arrow in

) whereas new

Sox10

-positive cells are still produced in the dorsal neural

tube on the contralateral side (phenotype seen in 83% of embryos, n=30). Overall, this leads

to a smaller size of the neural crest cell pool as visualized by the brackets with different

length. * marks the treated side. Scale bar 20μm. See also figure S2.

Kerosuo and Bronner

Page 17

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

Figure 3. cMyc Regulates Self-Renewal But Not Multipotency Of Neural Crest Cells

(A)

Self-renewal was measured

in vitro

by using the colony forming assay on crestospheres

(B)

that express high levels of

cMyc

mRNA as shown by

in situ

hybridization.

(C)

siRNA

knockdown of cMyc significantly reduces neural crest cell self-renewal capacity (siRNA1:

average=0.41 fold, SEM= 0.076; n=6; siRNA2: average= 0.54 fold, SEM 0.13, n=6;

CosiRNA average = 1 fold, SEM=0.152, n=12, ttest siRNA1/Co p=0.00358; siRNA2/Co

p=0.0355).

(D)

Reduced

cMyc

expression levels after siRNA knockdown (average for

siRNA1 = 0.577, SEM 0.121, n=3; siRNA2= 0.748, SEM 0.022: n=3).

(E)

cMyc

knockdown also reduces secondary sphere formation capacity (cMyc siRNA = 0.456208929,

sem 0.092996221 n=6; control siRNA = 1, sem= 0.237695836 n=6; p=0.04310364).

(F–G).

Differentiation of neural tube explants electroporated with cMycMO. cMyc deficient neural

crest cells were able to differentiate into all major types of neural crest derivatives:

melanoblasts (Mitf), Smooth muscle (SMA), neurons (TUJ1) and glial cells (BLBP) as a

proof of multipotency (n=24 embryos). Scale bar 50 μm.

Kerosuo and Bronner

Page 18

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

Figure 4. Neural Crest Cell Survival Requires cMyc

(A)

cMyc deficiency does not affect proliferation in a statistically significant way (cMycMO

average= 0.702, SEM 0.12; n=7 embryos; coMO=1, SEM 0.105; n=7 embryos),

(B, D)

although the dorsal neural tube has fewer cells on the Myc deficient side (on average 47 cells

in the tip of the dorsal neural tube, SEM 1.499, as compared to 55 cells on the tips on the

coMo side, SEM 1.51; n= 26 slides in 6 embryos, ttest p= 0.00020924);

(C, E–F)

likely due

to a massive decrease in cell survival as shown by Caspase 3 immunostaining (average =

4.13, SEM cMycMo 0.2039, n=6 embryos and CoMo 0.1700912, ttest p= 4.534E-07, n=6

embryos) and

(D, D

′

)

incorrect folding of the dorsal neural folds.

(G)

QPCR data shows no

change in known targets of cMyc involved in cell proliferation (

CyclinE:

cMycMo/CoMo

average 0.997, SEM 0.098, n=8; CoMo/CoMo average 1.1, SEM 0.22, n=4; ttest cMycMo/

CoMo p=0.63) or survival (

BCL2:

cMycMo/CoMo average 0.977, SEM 0.082, n=8; CoMo/

CoMo average 1.09, SEM 0.26, n=4; ttest cMycMo/CoMo p=0.62), even though neural crest

genes (

FoxD3, Sox10)

are downregulated (

FoxD3

cMycMo/CoMo average 0.41, SEM0.07,

n=6;

Sox10

cMycMo/CoMo average 0.50, SEM 0.08, n=6,

FoxD3

CoMo/CoMo average =

1.13, SEM 0.13, n=7;

Sox10

CoMo/CoMo average 1.03, SEM0.06, n=7; ttest cMycMO/

CoMo

FoxD3

p=0.00111,

Sox10

p= 0.00036). Instead, the CDKI p27 is increased in cMyc

morphants (cMycMO/CoMo average 1.39, SEM 0.148, n=7; CoMo/CoMo average 0.93,

SEM 0.082, n=4; ttest p=0.0215). This suggests an alternative mechanism for cMyc function

other than E-Box binding.

(H)

Immunostaining for proliferation (PH3) and apoptosis

Kerosuo and Bronner

Page 19

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript

(Caspase 3) in crestospheres transfected with cMycSiRNA.

(I–J)

Knockdown of cMyc does

not alter proliferation or cell survival in crestospheres (PH3 cMycSiRNA average=1.13,

SEM 0.17, n= 10; CosiRNA = 1, SEM 0.17; ttest p= 0.672; Caspase (cMycSiRNA average=

1.05, SEM= 0.11, n=10; control = 1, SEM 0.23, n=7, ttest p= 0.68).

(K)

Knockdown of

cMyc increses p27 mRNA levels in crestospheres (cMycsiRNA average=1.21; SEM= 0.06;

n=5; CoSiRNA=1, n=6, p=0.025). * marks the treated side. Scale bar 50 μm. See also figure

S3A,B.

Kerosuo and Bronner

Page 20

Cell Rep

. Author manuscript; available in PMC 2017 December 12.

Author Manuscript