Widespread and targeted gene expression by systemic AAV vectors: Production, purification, and administration

Widespread and targeted gene expression

by systemic AAV vectors:

Production, purification, and administration

Rosemary C Challis

, Sripriya Ravindra Kumar

, Ken Y Chan

, Collin Challis

, Min J Jang

Pradeep S Rajendran

, John D Tompkins

, Kalyanam

Shivkumar

, Benjamin E Deverman

and Viviana Gradinaru

Division of Biology and Biological Engineering,

California Institute of Technology

Pasadena, CA

Cardiac Arrhythmia Center and Neurocardiology Research Center of Excellence, University of

Calif

ornia, Los Angeles

Los Angeles, CA

*To whom correspondence should be addressed:

Viviana Gradinaru, Ph.D.

Division of Biology and Biological Engineering

California Institute of Technology

1200 East California Blvd. MC 156-29

Pasadena, CA 91125

Phone: (626) 395-6813

viviana@caltech.edu

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

ABSTRACT

We recently developed novel AAV capsids for efficient and noninvasive gene transfer across the

central and peripheral nervous systems. In this

protocol, we describe how to produce and

systemically

administer AAV-PHP viruses to label

and/or genetically

manipulate cells in the

mouse nervous system and organs including the heart. The procedure comprises three

separate

stages: AAV production, intravenous delivery, and evaluation of transgene expression.

The

protocol spans

eight days, excluding the time required to assess gene expression, and can

be readily adopted by laboratories with standard molecular and cell culture capabilities. We

provide guidelines for experimental design

and choosing the

capsid,

cargo, and viral dose

appropriate for the experimental aims

. The procedures outlined here are adaptable to diverse

biomedical applications, from anatomical and functional mapping to gene

expression,

silencing,

and editing.

INTRODUCTION

Recombinant adeno-associated viruses (AAVs) are commonly used

vehicles for

in vivo

gene

transfer

and promising vectors for therapeutic applications

. However, AAVs that enable efficient

and noninvasive gene delivery across defined

cell populations are

needed. Current gene

delivery methods

(e.g., intraparenchymal surgical injections)

are invasive, and alternatives such

as intravenous administration

require

high

viral doses

and still provide relatively inefficient

transduction of target cells. We previously developed CREATE (Cre REcombination-based AAV

Targeted Evolution)

engineer and screen for

AAV capsids capable of more efficient

gene

transfer to specific cell types

via the vasculature

2,3

. Compared

to naturally occurring capsids, the

novel AAV

-PHP capsids exhibit markedl

y improved tropism for

cells in

the

adult mouse central

nervous system

(CNS), peripheral nervous system (PNS), and visceral organs. In this

protocol,

we describe how to package genetic cargo into AAV

-PHP capsids

and intravenously administer

AAVs for efficient and noninvasive

gene delivery

throughout the body (

Fig. 1

We recently identified several new capsid variants with distinct tropisms

2,3

. AAV-PHP.B

and the further evolved

AAV-PHP.eB

efficiently transduce

neurons and glia throughout the CNS

(

Fig. 2

); a second

variant, AAV

-PHP.S,

display

s improved tropism for neurons within the PNS

(

Fig. 3

)

and

organs

including the gut

and heart (

Fig. 4

Importantly, these capsids

target cell

populations

that are

normally

difficult to access due to their location

(e.g., sympathetic, nodose,

dorsal root, and cardiac ganglia) (

Fig. 3a-c

and

Fig. 4d

)

or broad distribution

(e.g.,

throughout

the brain or

enteric nervous system) (

Figs. 2

and

Together with the capsid, the genetic

cargo (or AAV genome) can be customized to control transgene expression (

Fig. 5

and

Table

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

). The

recombinant AAV (rAAV)

genome contains the components required for gene

expression including promoters, transgenes, protein trafficking

signals, and recombinase-

dependent expression

schemes

. Hence, different capsid-cargo combinations create a versatile

AAV toolbox for genetic manipulation of diverse cell populations in

wild-type and transgenic

animals.

Here

, we provide researchers, especially those new to working with AAVs or systemic

delivery

, with

res

ources to utilize AAV

-PHP viruse

s in their own research.

Overview of the protocol

We provide an instruct

ion manual for users of AAV-PHP variants. The procedure includes three

main stages

(

Fig. 1

AAV production (Steps 1-42), intravenous delivery (Steps 43-49), and

evaluation of transgene expression

(Step 50).

The AAV production protocol is adapted from established methods.

First,

HEK293T cells

are transfected with three plasmids

4-6

(Steps 1-3) (

Figs

. 1

and

): (1)

pAAV, which contains the

rAAV genome of interest (

Fig. 5

and

Table 1

);

(2) AAV-PHP Rep

-Cap, which encodes the viral

replication and capsid proteins; and (3) pHelper, which encodes adenoviral

proteins

necessary

for

replication.

Using this triple transfection approach, the

rAAV genome is packaged into an

AAV-PHP capsid

in HEK293T cells. AAV-PHP viruses

are then harv

ested

(Steps

4-14),

purified

8,9

(Steps

15-31), and titered

(Steps

32-42) (

Fig. 6

). Purified

viruses are

intravenously

delivered

to mice

via retro-orbital injection

(Steps 43-49) and gene expression

is later

assessed

using molecular, histological, or functional methods relevant to the experimental aims

(Step 50).

This protocol is optimized to produce AAVs at high titer (over 10

vector genomes/ml)

and with high transduction efficiency

in vivo

2,3

Experimental design

Before proceeding with

the protocol, a number of factors should be considered, namely the

expertise and resources available in the lab; the capsid and rAAV genome to be used; the

dose

for intravenous administration; and the method(s) available for assessing transgene expression.

Each of these topics is discussed below and intended to guide users in designing their

experiments.

Required expertise

and resources.

This

protocol requires

that scientists have basic molecular

biology, cell culture, and animal work experience.

Users should be approved to handle

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

laboratory animals, human cell lines, and AAVs.

A background in molecular cloning is

advantageous

though not necessary if relying on available plasmids.

In addition to having the above expertise, labs must

equipped for

the molecular and

cell culture work relevant to the procedure; we suggest that users read through the entire

materials and procedure sections beforehand to ensure that the required reagents and

equipment are available and appropriate safety practices and institutional approvals are in

place.

Selecting an AAV

-PHP capsid.

We recommend choosing an AAV

-PHP capsid

based on its

tropism and viral production efficiency. Capsid properties are listed in

Supplementary Table 1

;

we include species, organs, and cell populations examined to date and note typical viral yields.

We anticipate that most researchers will use AAV

-PHP.eB (Addgene ID 103005) or AAV

-PHP.S

(Addgene ID 103006) in their

experiments.

AAV-PHP.

eB and AAV-PHP.S

produce viral yields

similar to other high producing naturally occurring serotypes (e.g., AAV9) and enable efficient,

noninvasive gene transfer to the CNS or PNS and visceral organs, respectively

(

Figs. 2-4

The earlier

capsid

variants, which provide broad CNS transduction, either

produce

suboptimal yields (

AAV-PHP.A)

or have since been further evolved for enhanced transduction

efficiency

in vivo

(AAV-PHP.B (Addgene ID

103002))

. We therefore recommend using AAV-

PHP.eB for CNS applications, especially when targeting neurons

. Note, however, that the

chosen capsid will ultimately depend on the experimental circumstances; multiple factors

including species

, age

, gender

, and health

influence

AAV trop

ism. Testing

the AAV

-PHP

variants in a variety of experimental paradigms will continue to reveal the unique attributes of

each capsid and identify those most suitable for different applications.

Selecting a rAAV genome.

Users must select a rAAV genome, contained in a pAAV plasmid,

to package into the capsid (

Figs

. 1

and

Table 1

). In

Table 1

, we list pAAVs used here

(

Figs. 2-4

) and in our previous work

2,3

; we direct users to Addgene’s plasmid repository for

additional pAAVs developed for various applications.

Depending on the experimental aims, users may elect to design their own genomes

and clone from existing pAAVs. When customizing plasmids, it is imperative that the rAAV

genome, the sequence between and including the two inverted terminal repeats (ITRs), does

not exceed

4.7-5 kb (

Fig. 5

); larger genomes will not be fully packaged into AAV capsids,

resulting in truncated genomes and low titers. The ITRs are 145 base pair sequences that flank

the expression cassette and are required for replication and encapsidation of the viral genome.

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

ITRs are typically derived from the AAV2 genome and must match the serotype of the

rep

gene

contained in the AAV Rep-C

ap plasmid; AAV

-PHP Rep

-Cap plasmids contain the AAV2

rep

gene and are therefore capable of packaging genomes with AAV2 ITRs.

Other genetic

components (e.g., promoters, transgenes, localization signals, and recombination scheme

s) are

interchangeable and can be customized for specific

applications

(

Fig. 5

Dos

age for intravenous administration.

The optimal dose for intravenous

administration to

target cell populations must be determined empirically. We encourage users to consult

Figures

2-4

and related work for suggested AAV

-PHP viral doses. The variants have been successfully

employed for

fluorescent labeling

in adult mice

2,3,17

(

Figs. 2-4

), neonatal mice

, and neonatal

and adult rats

; they have also been administered for calcium imaging

19,20

and optogenetic (

Fig.

chemogenetic

, and therapeutic

applications

17,18

For applications using AAV

-PHP.eB and AAV-PHP.S, we typically administer between 1

x 10

and 3 x 10

vector genomes (vg) of virus to adult mice (≥6 weeks of age)

. However,

dosage will vary depending on the

target cell population,

desired fraction

of transduced cells

and expression level per cell. AAVs

independently and stochastically transduce cells, typically

resulting in multiple genome copies per cell

. Therefore, higher doses generally result in

strong

expression (i.e., high copy number) in a large fraction of cells, whereas low

doses result in

weaker

expression (i.e., low copy number) in a small

fraction

of cells. To achieve high

expression

in a sparse subset of cells, users can employ a

two

-component

system in which

transgene expression is dependent on

co-transduction of

an inducer

(e.g., a vector expressing

the tetracycline-controlled transactivator (tTA))

; inducers are injected at a lower dose (typically

1 x 10

to 1 x 10

vg) to limit t

he fraction of cells with transgene expression.

Note that gene

regulatory elements

(e.g., enhancers and promoters)

also influence gene expression levels.

Therefore, users should assess transgene expression from a series of doses and at several

time points after intravenous delivery to determine the optimal experimental conditions

Evaluation of transgene expression.

Following

in vivo

delivery, AAV transduction and

transgene expression increase over the course of several weeks. While expression is evident

within days after transduction, it does not reach a steady state level until at least 3-

4 weeks.

Therefore, we suggest waiting a minimum of 2 weeks before evaluating

fluorescent

labeling

2,3,17,18

(

Figs. 2-4

) and at least 3-4 weeks before beginning optogenetic (

Fig. 4d

chemogenetic

, and calcium imaging

19,20

experiments.

Note that

like other AAVs, AAV-PHP

variants are capable of providing long-term transgene expression. AAV-PHP.B-

mediated

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

cortical

expression of a genetically encoded calcium indicator,

GCaMP6s, was reported to last

at least 10 weeks post-injection without toxic side effects

(i.e., nucl

ear filling

), and we have

observed

GFP expression

throughout the brain

re than one year after viral administration

(see Supplementary Figure 4 in ref.

). However,

the time points suggested

here are only meant

to serve as guidelines

; gene expression is contingent on multiple factors including the animal

model, capsid, genome, and dose.

e appropriate method(s) for evaluating transgene expression will vary among users

Fluorescent protein

expression

can be assessed in thin or

thick

(≥

100 μm

) tissue samples

. The

CLARITY

-based

methods PACT (passive CLARITY technique) and PARS (perfusion-assisted

agent release

in situ

)

render thick tissues optically transparent while preserving their

three-

dimensional

molecular and cellular architecture and facilitate deep imaging of large volumes

(e.g., via confocal or light-sheet microscopy)

. Cleared tissues are compatible with endogenous

fluorophores including

commonly used markers like GFP

3,22,24

, eYFP

, and tdTomato

However, some fluorescent signals, such as those from mTur

quoise2, mNeonGreen, and

mRuby2

, can deteriorate

in chemical clearing reagents. To visualize these reporters, we

suggest using optical clearing methods

RIMS (refractive index matching solution)

Sca

eSQ

(

Figs. 3a

and

, and

4b-c

), or commercially available mounting media like Prolong

Diamond Antifade (Thermo Fisher Scientific, cat. no.

P36965)

(

Fig. 2

See the Anticipated

Results section for

details on expected outcomes when using fluorescent reporters.

We recognize that fluorescent labelling is not desired or feasible for every application

. In

such cases, users must identify the appropriate method(s) for examining transduced cells,

which may include molecular (e.g., qPCR or Western blot), histological

(e.g. with antibodies,

small molecule dyes, or molecular probes) or functional (e.g., optical

imaging)

approaches.

Limitations of the method

A major limitation of AAV capsids, including AAV-PHP variants, is their relatively small

packaging capa

city

(<5 kb).

Some elements of the rAAV genome

, such as the WPRE (see

legend in

Fig

ure

), can be truncated

removed

27,28

accommodate larger genetic

components. T

he development

of smaller promoters

29,30

and

dual expression systems

, in

which genetic elements are split between two or more viruses (requiring efficient

cotransduction),

hav

e also

enabled

the delivery of

larger

genomes

. Continued development of

these approaches will

help bypass restrictions

rAAV genome size.

Intravenous administration of AAVs

also

presents unique challenges. For example,

systemic

transduction

may be undesirable for applications in which highly restricted gene

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

expression is vital to the experimental outcome.

Possible off-

target transduction, due to the

broad tropism of AAV-

PHP variants and/or lack of compatible cell type-specific promoters, can

be reduced by microRNA (miRNA)

-mediated gene silencing. Sequences complementary to

miRNAs expressed in off

-target cell populations can be introduced in

the 3’ UTR

of the rAAV

genome (

Fig. 5

); this has been shown to

reduce off-target

transgene expression

and restrict

expression to cell types

of interest

32,33

Another challenge of systemic delivery is that it requires a high viral load, which can

illicit

immune response against the capsid

and/or transgene and reduce transduction efficiency

vivo

. Immunogenicity of

AAVs may be exacerbated by empty capsid contamination in viral

preparations

35,36

. The

viral purification protocol (Steps 15-31)

provided here reduces, but does

not eliminate, empty capsids (

Fig. 6b

). If

this poses a concern for specific applications, viruses

can be purified using an alternative approach

7,8,37

Lastly, generating viruses

for systemic administration may impose a financial burden on

laboratories due to the doses of virus required. Nevertheless,

viral

-mediated gene delivery is

inexpensive compared to creating and

maintaining transgenic animals. Moreover, intravenous

injection is faster, less invasive, and less technically demanding than other routes of AAV

administration, such as stereotaxic injection, thereby eliminating the

need for specialized

equipment and survival surgery training.

Applications of the method

We anticipate that AAV-PHP

capsids can be used with the growing pAAV plasmid repository

available through Addgene and elsewhere to enable

a wide range of biomedical

applications

(

Fig. 5

and

Table 1

Below, we highlight a few current and potential

applications

of this method.

Anatomical mapping.

luorescent reporters are commonly used for cell type-specific mapping

and phenotyping

2,38,39

(

Figs. 2-4

). AAV-mediated

multicolor labeling (e.g., Brainbow

) is

especially advantageous for anatomical mapping approaches that require individual cells in the

same population to be distinguished from one another. We and others have demonstrated the

feasibility of this approach in the brain

2,40

, retina

, heart (

Figs

. 4b

and

), and gut

, as well as

peripheral ganglia (

Fig. 3c

). Spectrally distinct labeling is

well

-suited for studying the

organization of cells

(e.g., cardiomyocytes (

Fig. 4b

)) in

healthy and

diseased tissues

and long-

range tract tracing of individual fibers through

extensive neural

networks

(e.g., the enteric

cardiac nervous systems (

Fig. 4c

)).

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

Functional mapping.

AAV-PHP capsids are

also relevant for probing cell function. AAV-PHP.B

was previously used to target distinct neural circuits

throughout the brain for

chemogenetic

and optical imaging

applications

19,20

. We predict that AAV

-PHP viruses

will be beneficial for

manipulating

neural

networks that

are typically difficult to access, such as peripheral circuits

controlling the heart (

Fig. 4d

), lungs

, or gut

. AAV-PHP variants could also be utilized to

interrogate the function of non-neuronal cell types including cardiomyocytes

, pancreatic beta

cells

44,45

, and hepatocytes

. Harnessing AAV-PHP viruses

modulate cell physiology may

reveal novel roles for different cells in regulating

organ function and/or animal behavior.

Gene

expression, silencing,

and editing.

AAV-PHP viruses are well

-suited for assessing

potential therapeutic strategies that would benefit from organ-wide or systemic transgene

expression. Recently, AAV-PHP.B was used to treat

and model

neurodegenerative diseases

with widespread pathology

. Other potential applications include gene editing

(e.g., via

CRISPR

47,48

) or silencing (e.g., via short hairpin RNA (shRNA)

49,50

); importantly, these

approaches could be utilized to broadly and noninvasively manipulate cells in both healthy and

diseased states for either basic research or therapeutically motivated studies.

Summary

Systemically delivered AAV-PHP v

iruses

provide

efficient, noninvasive, and long-term

gene

transfer

to cell types throughout the adult CNS, PNS, and visceral organs. Together with the use

of custom rAAV genomes (

Fig. 5

and

Table 1

), researchers can target genetic elements to

defined c

ell populations for diverse applications.

MATERIALS

REAGENTS

Plasmid DNA preparation

●

Plasmids, supplied as bacterial stabs (Addgene; see

Table 1

for plasmids used in this and

related work)

CRITICAL

Three plasmids (pAAV, capsid, and

elper) are required for

transfection (

Fig. 1

●

Agarose (Amresco, cat. no. N605-250G)

●

Antibiotics (e.g., carbenicillin disodium salt, Alfa Aesar, cat. no. J61949-

06; all plasmids

used in this work carry antibiotic resistance genes to ampicillin/carbenicillin)

●

DNA ladder, 2-log, 0.1-10.0 kb (New England Biolabs, cat. no. N0550S)

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

●

Lysogeny broth (LB) (Amresco, cat. no. J106-1KG); for large-scale plasmid preparations,

such

as maxi

- and giga-preps, we typically use Plasmid+ media (Thomson Instrument

Company, cat. no. 446300), an enriched media formulated to support higher cell densities

and plasmid yields compared to LB

●

Lysogeny broth (LB) with agar (Sigma-Aldrich, cat. no. L3147-1KG)

●

NucleoBond Xtra Maxi Endotoxin-Free (EF) plasmid purification kit (Macherey

-Nagel, cat.

no. 740424.50) CRITICAL

Triple transient transfection requires large amounts of capsid

(22.8 μg/dish) and pHelper plasmid DNA (11.4 μg/dish) (

Supplementar

y Table 2

, sheet

‘Detailed calculations’

); isolating these plasmids may be more convenient with a giga

scale purification kit (NucleoBond PC 10000 EF, Macherey

-Nagel, cat. no. 740548). All

plasmids should be purified under endotoxin-free conditions. Endotoxin contamination in

plasmid preparations can reduce transfection efficiency, and contaminating endotoxins in

viral preparations could elicit immune reactions in mammals

in vivo

●

Res

triction enzymes

, including SmaI

(New England Biolabs, cat. no. R0141S); used for

verifying plasmid and ITR integrity

●

Sequencing primers (Integrated DNA Technologies); used for verifying plasmid integrity

●

SYBR Safe DNA gel stain (Invitrogen, cat. no. S33102)

●

Tris-acetate

-EDTA (TAE) buffer, 50X (Invitrogen, cat. no. B49)

Cell culture

●

Human embryonic kidney (HEK) cells, 293 or 293T (ATCC, cat. no.

CRL 1573 or CRL

3216)

CAUTION

HEK cells pose a moderate risk to laboratory workers and the

surrounding environment and must be handled according to governmental and

institutional regulations. Experiments involving HEK cells are performed using Biosafety

Level 2 practices as required by

the California Institute of Technology and the U.S. Centers

for Disease Control and Prevention. The cell line identity has not been validated, nor do

we routinely test for mycoplasma.

CRITICAL

HEK293

and HEK293T cells constitutively

express two

adenoviral

genes, E1a

and E1b, which are required for AAV production

these cells

; we

do not

recommend using an alternative

producer

cell line

with this

protocol

●

Dulbecco’s Modified Eagle Medium (DMEM), high glucose, GlutaMAX supplement,

pyruvate (Gibco, cat. no. 10569-044)

●

Ethanol, 70% (v/v); prepare from absolute ethanol (J.T. Baker, cat. no. 8025) CAUTION

Ethanol is flammable.

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

●

Fetal bovine serum (FBS) (GE Healthcare, cat. no. SH30070.03)

CRITICAL

Aliquot and

store at -

20 ̊C for up to 1 year. Avoid freeze/thaw

cycles.

●

MEM Non

-Essential Amino Acids (NEAA) solution, 100X (Gibco, cat. no. 11140-050)

●

Penicillin

-Streptomycin (Pen-Strep), 5000 U/ml (Gibco, cat. no. 15070-063)

CRITICAL

Aliquot and store at -

20 ̊C for up to 1 year. Avoid freeze/thaw cycles.

●

TrypLE Express enzyme, 1X, phenol red (Gibco, cat. no. 12605-036)

Transfection

●

Plasmid DNA CRITICAL

We use a pAAV:capsid:pHelper plasmid ratio of 1:4:2 based on

μg of DNA. We use 40 μg of total DNA per 150 mm dish (5.7 μg of pAAV, 22.8 μg of

capsid, and 11.4 μg of pHelper) (

Supplementary Table 2

, sheet

‘Detailed calculations’

●

Polyethylenimine (PEI), linear, MW 25000 (Polysciences, Inc., cat. no. 23966-2)

●

Water for Injection (WFI) for cell culture (Gibco, cat. no. A1287304)

●

1X Dulbecco’s PBS (DPBS), no calcium, no magnesium (Gibco, cat. no. 14190-250)

●

1 N HCl solution, suitable for cell culture (Sigma

-Aldrich, cat. no. H9892)

CAUTION

HCl

is corrosive. Use personal protective equipment.

AAV production

●

Bleach, 10% (v/v); prepare fresh from concentrated liquid bleach (e.g., Clorox)

CRITICAL

AAV-contaminated materials must be disinfected with bleach prior to disposal; ethanol is

not an effective disinfectant. Experiments involving AAVs follow a standard operating

procedure in which contaminated equipment, surfaces, and labware are disinfected for 10

min with 10% bleach. AAV waste disposal should be conducted according to federal, state,

and local regulations.

●

Dry ice; optional

●

KCl (any)

●

MgCl

(any)

●

NaCl (any)

●

OptiPrep (60% (w/v) iodixanol) density gradient media (Cosmo Bio USA, cat. no. AXS

1114542-5)

●

Phenol red solution (Millipore, cat. no. 1072420100)

●

Pluronic F-68 non-ionic surfactant, 100X (Gibco, cat. no. 24040-032); optional

●

Polyethylene glycol (PEG), MW 8000 (Sigma-Aldrich, 89510

-1KG-F)

●

Salt-active nuclease (SAN) (ArcticZymes, cat. no. 70910-202)

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

●

Tris base (any)

●

Ultrapure DNAse/RNAse-free distilled water (Invitrogen, cat. no. 10977-023)

●

Water for Injection (WFI) for cell culture (Gibco, cat. no. A1287304)

●

1X Dulbecco’s PBS (DPBS), no calcium, no magnesium

(Gibco, cat. no. 14190-250)

AAV titration

●

AAVs

●

CaCl

(any)

●

DNAse I recombinant, RNAse-free (Sigma-Aldrich, cat. no. 4716728001)

●

HCl, 37% (wt/wt) (Sigma

-Aldrich, cat. no. 320331

-500ML)

●

MgCl

(any)

●

NaCl (any)

●

-lauroylsarcosine

sodium salt (Sigma-Aldrich, cat. no. L9150

-50G)

●

Plasmid DNA containing the target sequence (e.g., pAAV

-CAG-eYFP, Addgene ID

104055); used for preparing the DNA standard stock

CRITICAL

The plasmid used to

make

the DNA standard must contain the same target sequence as the pAAV plasmid used to

generate virus. The target sequence must be within the rAAV genome; we typically amplify

a portion of the WPRE in the 3’ UTR of pAAVs (see legend in

Fig. 5

●

Primers corresponding to the target sequence (Integrated DNA Technologies)

WPRE

-forward:

GGCTGTTGGGCACTGACAAT

WPRE

-reverse:

CCGAAGGGACGTAGCAGAAG

CRITICAL

The proximity of the primer binding sites to the ITRs can affect titering

results;

therefore, titers measured with different primers or across laboratories may not be directly

comparable.

●

Proteinase K, recombinant, PCR grade (Sigma-

Aldrich, cat. no. 03115828001)

●

Qubit dsDNA HS assay kit (Invitrogen, cat. no. Q32854)

●

ScaI-HF restriction enzyme (New England Biolabs, cat. no. R3122S) or other enzyme that

cuts outside of the rAAV genome and within the pAAV backbone

●

SYBR green master mix (Roche Diagnostics, cat. no. 04913850001)

●

Tris base (any)

●

Ultrapure DNAse/RNAse-free distilled water (Invitrogen, cat. no. 10977-

023)

●

Ultrapure EDTA, 0.5 M, pH 8.0 (Invitrogen, cat. no. 15575-020)

Intravenous

(retro

-orbital) injection

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

●

AAVs

●

Animals to be injected. This protocol describes the production of AAVs for intravenous

delivery to

6-8 week old

wild-type (C57BL/6J), ChAT-IRES

-Cre (Jackson Laboratory,

stock no. 028861, heterozygous), TH

-IRES

-Cre (European Mutant Mouse Archive, stock

no. EM00254, heterozygous), and TRPV1-IRES-Cre mice (Jackson Laboratory, stock no.

017769, homozygous). CAUTION

Experiments on vertebrates must conform to all

relevant governmental and institutional regulations. Animal husbandry and experimental

procedures involving mice were approved by the Institutional Animal Care and Use

Committee (IACUC) and the Office of Laboratory Animal Resources at the California

Institute of Technology.

●

Bleach, 10% (v/v) prepared fresh, or equivalent disinfectant (e.g., Accel TB surface

cleaner, Health Care Logistics, cat. no. 18692)

●

Isoflurane, USP (Piramal Healthcare, 66794-017-25)

CAUTION

Isoflurane is a

halogenated anesthetic gas associated with adverse health outcomes in humans and

must be handled according to governmental and institutional regulations. To reduce the

risk of occupational exposure during rodent anesthesia, waste gas is collected in a

biosafety cabinet using a charcoal scavenging system as approved by the California

Institute of Technology.

●

Proparacaine hydrochloride ophthalmic solution, USP, 0.5% (Akorn Pharmaceuticals, cat.

no. 17478-263-12)

●

1X Dulbecco’s PBS (DPBS), no calcium, no magnesium (Gibco, cat. no. 14190-250)

-------------------------------------------------------------------------------------------------------------------------------

EQUIPMENT

Plasmid DNA preparation equipment

●

Autoclave (any, as available)

●

Bunsen burner and lighter (Fisher Scientific, cat. nos. 03-917Q and S41878A)

●

Centrifuge (see requirements for chosen plasmid purification kit)

●

Gel electrophoresis system (Bio-Rad horizontal electrophoresis system)

●

Gel imaging system (Bio-Rad Gel Doc EZ model)

●

Incubating shaker (Eppendorf I24 model)

●

Incubator (Thermo Fisher Scientific Heratherm model) or 37 ̊C warm room

●

Sequence editing and annotation software (e.g., Lasergene by DNASTAR, SnapGene by

GSL Biotech, or VectorNTI by Thermo Fisher Scientific)

●

Spectrophotometer (Thermo Fisher Scientific NanoDrop model)

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

Plasmid DNA preparation supplies

●

Petri dishes, 100 mm x 15 mm (Corning, cat. no. 351029)

●

Test tubes, 14 ml (Corning, cat. no. 352059)

●

Ultra Yield flasks and AirOtop seals, 250 ml (Thomson Instrument Company, cat. nos.

931144 and 899423); use with Plasmid+ media. Alternatively, use LB and standard

Erlenmeyer flasks.

AAV production equipment

●

Biological safety cabinet

CAUTION

HEK293T cells and AAVs are biohazardous materials

and must be handled according to governmental and institutional regulations. All

experiments involving the aforementioned materials are performed in a Class II biosafety

cabinet with annual certification as required by the California Institute of Technology and

the U.S. Centers for Disease Control and Prevention.

●

Centrifuge (any, provided the instrument can reach speeds up to 4,000 x

, refrigerate to

4 ̊C, and accommodate 250 ml conical centrifuge tubes; we

use the Beckman Coulter

Allegra X

-15R model)

●

Fluorescence microscope for cell culture (Zeiss Axio Vert.A1 model)

●

Incubator for cell culture, humidified at 37 ̊C with 5% CO

(Thermo Fisher Scientific

Heracell 240i model)

●

Laboratory balance (any, with a readability of 5-

10 mg)

●

Support stand with rod and clamp (VWR International, cat. nos. 12985-

070, 60079-

534,

and

89202-624) (

Fig. 7f

)

●

Ultracentrifuge (any preparative ultracentrifuge for

in vitro

diagnostic use; we use the

Beckman Coulter Optima XE-9 model with the Type 70Ti rotor) CAUTION

During

ultracentrifugation, rotors are subjected to enormous forces (up to 350,000 x

in this

protocol). Rotor failure can have catastrophic consequences including irreparable damage

to the centrifuge and laboratory and fatal injuries to personnel. Inspect rotors for signs of

damage or weakness prior to each use, and always follow the manufacturer’s instructions

while operating an ultracentrifuge.

●

Water bath (Fisher Scientific Isotemp model)

AAV production supplies

●

Amicon Ultra-15 centrifugal filter devices, 100 KDa molecular weight cutoff (Millipore, cat.

no. UFC910024)

●

Barrier pipet tips, 1000 μl (Genesee Scientific, cat. no. 23-430)

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

●

Cell scrapers, 25 cm handle x 3 cm blade (Corning, cat. no. 353089)

●

Conical centrifuge tubes, 50 ml and 250 ml (Corning, cat. nos. 352098 and 430776)

●

Empty, sterile media bottles

●

OptiSeal tubes (Beckman Coulter, cat. no. 361625); includes black caps

●

OptiSeal tube kit (Beckman Coulter, cat. no. 361662); includes a tube rack, spacers, and

spacer and tube removal tools

●

Pipet Aid XL portable pipetting device (Drummond, cat. no.

4-000-105)

CRITICAL

Use a

pipetting device with precise control, which is essential for pouring the density gradients

in Step 16.

●

pH indicator strips (Millipore, cat. nos. 109532 and 109584)

●

Screw-cap vials, 1.6 ml (National Scientific Supply Co., cat. no. BC16NA-PS)

●

Serolo

gical pipets, 2 ml, 5 ml, 10 ml, 25 ml, and 50 ml (Corning, cat. no. 356507 and

Genesee Scientific, cat. nos. 12-102, 12-104, 12-106, and 12-107)

CRITICAL

Only

Corning brand 2 ml serological pipets consistently fit into OptiSeal tubes while pouring the

density gradients in Step 16. Alternatively, attach a small piece of clear tubing

(6 mm)

(e.g., Tygon Tubing) to a

5 ml pipet to pour the gradients.

●

Stericup

sterile vacuum filtration system, 0.22 μm, 500 ml and 1 L (Millipore, cat. nos.

SCGPU05RE and SCGPU11RE)

●

Sterile bottles, 500 ml (VWR International, cat. no. 89166-106)

●

Syringes, 5 ml and 10 ml (BD, cat. nos. 309646 and 309604)

●

Syringe filter unit, 0.22 μm (Millipore, cat. no. SLGP033RS)

●

Tissue culture dishes, 150 mm x 25 mm (Corning, cat. no. 430599)

●

16 G x 1 ½ in needles (BD, cat. no. 305198)

AAV titration equipment

●

Centrifuge (Eppendorf, 5418 model)

●

Dry bath and heating blocks (Fisher Scientific Isotemp models)

●

PCR plate spinner (VWR International, cat. no. 89184) or centrifuge equipped with plate

adapters

●

Quantitative PCR machine (any)

●

Qubit 3.0 fluorometer (Invitrogen, cat. no. Q33216)

AAV titration supplies

●

Barrier pipet tips, 10 μl, 20 μl, 200

μl, and 1000 μl (Genesee Scientific, cat. nos. 23-

401,

23-404, 23-412, and 23

-430)

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

●

DNA clean

-up kit, for purification of up to 25

μg of DNA standard (Zymo Research, cat.

no. D4033)

●

Microcentrifuge tubes, 1.5 ml DNA/RNA LoBind (Eppendorf, cat. no. 86-923)

●

Qubit assay tubes (Invitrogen, cat. no. Q32856)

●

Sealing film for 96-well PCR plates (Genesee Scientific, cat. no. 12-529)

●

Stericup sterile vacuum filtration system, 0.22 μm, 250 ml (Millipore, cat. no.

SCGPU02RE)

●

Sterile bottles, 250 ml (VWR International, cat. no. 89166-104)

●

96-well PCR plates (Genesee Scientific, cat. no. 24-310W)

Intravenous (retro-orbital) injection equipment

●

Animal anesthesia system (VetEquip, cat. nos. 901806, 901807, or 901810) CRITICAL

Most animal facilities provide anesthesia systems equipped with an induction chamber,

isoflurane vaporizer, nose cone, and waste gas scavenging system. In our experience, a

mobile anesthesia system is most convenient for administering AAVs in a biosafety

cabinet.

Intravenous

(retro

-orbital) injection supplies

●

Activated charcoal adsorption filters (VetEquip, cat. no. 931401)

●

Insulin syringes with permanently attached needles, 31 G x 5/16 in (BD, cat. no. 328438)

●

Oxygen gas supply (any)

●

Screw-cap vials, 1.6 ml (National Scientific Supply Co., cat. no. BC16NA

-PS)

---------------------------------------------------------------------------------------------------------------------

REAGENT SETUP

CRITICAL All solutions should be prepared in a biosafety cabinet using sterile technique and

endotoxin-free reagents and supplies. Glassware, stir bars, and pH meters are not endotoxin-

free; autoclaving does not eliminate endotoxins. To prepare solutions, use pH indicator strips,

dissolve reagents by heating and/or inverting to mix, and use demarcations on bottles to bring

solutions up to the final volume. Reagents can be weighed outside of a biosafety cabinet since

all solutions are filter sterilized before use.

Plasmid DNA

Grow bacterial stocks in LB or Plasmid+ media containing the appropriate

selective antibiotic. Use a large-scale endotoxin-free plasmid purification kit to isolate plasmids;

elute plasmid DNA with the supplied Tris

-EDTA (TE) buffer. Measure DNA purity and

concentration using a spectrophotometer and freeze at -

20 ̊C or

80 ̊C for up to several years.

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

CRITICAL Always verify the integrity of purified plasmids by sequencing and restriction digest

before proceeding with downstream applications. pAAV plasmids contain inverted terminal

repeats (ITRs) (

Fig. 5

) th

at are prone to recombination in

E. coli

. pAAVs should be propagated

in recombination deficient strains such as NEB Stable (New England Biolabs, cat. no. C3040H),

Stbl3 (Invitrogen, cat. no. C737303),

or SURE 2 competent cells (Agilent, cat. no. 200152) to

prevent unwanted recombination. After purification, pAAVs should be digested with SmaI to

confirm the presence of ITRs, which are required for replication and encapsidation of the viral

genome; use sequence editing and annotation software to determine expected band sizes

. Note

that it is difficult to sequence through

the secondary structure of ITRs

; avoid ITRs when

designing sequencing primers.

DMEM + 5% (v/v) FBS

Add 25 ml of FBS, 5 ml of NEAA, and 5 ml of Pen-Strep to a 500 ml

bottle of DMEM. Invert to mix and store at 4 ̊C for up to several months. The resulting cell

culture media should have a final concentration of 5% (v/v) FBS, 1X NEAA, and 50 U/ml Pen-

Strep.

Cell culture

Thaw HEK293T cells according to the manufacturer’s recommendations. Passage

cells using either TrypLE Express enzyme or a standard trypsinization protocol for adherent

cultures

. Seed cells in 150 mm tissue culture dishes with a final volume of 20 ml of DMEM +

5% FBS per di

sh. Maintain in a cell culture incubator at 37 ̊C with 5% CO

. CRITICAL

suggest a passage ratio of 1:3 (i.e., divide one dish of cells into three new dishes of cells every

other day) when expanding cells for viral production; split cells at 1:2 (or 6 x 10

cells/cm

) 24 hr

before transfection. Always use sterile technique.

PEI stock solution

Pipet 50 ml of WFI water into a 50 ml conical centrifuge tube for later use.

Add 323 mg of PEI to the remaining 950 ml bottle of WFI water and adjust the pH to 2-3

adding 1 N HCl suitable for cell culture, keeping track of the volume of HCl added. Heat in a

37 ̊C water bath for several hours (or overnight) and occasionally shake to mix. Once dissolved,

add reserved WFI water to a total volume of 1 L. Filter sterilize, aliquot to 50 ml conical

centrifuge tubes, and store at -

20 ̊C for up to 1 year. We routinely freeze/thaw our PEI aliquots.

CRITICAL

Both our PEI stock solution recipe and PEI calculations (

Supplementary Table 2

sheet ‘Detailed calculations’) are based on ref.

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

PEI + DPBS master mix

Thaw PEI in a 37 ̊C water bath. Bring PEI to RT and vortex to mix.

Add PEI and DPBS to a 50 ml conical centrifuge tube and vortex again to mix. Use

Supplementary Table 2

(sheet ‘Transfection

calculator’)

to calculate the volumes of PEI (cell

I9) and DPBS (cell J9)

needed.

CRITICAL

Prepare fresh the day of transfection.

DNA + DPBS

Bring plasmid DNA to RT and briefly vortex to mix.

For each viral prep, add DNA

and DPBS to a 50 ml conical centrifuge tube and use a P1000 pipet to mix. Use

Supplementary Table 2

(sheet ‘Transfection

calculator’)

to calculate the quantities of DNA

(e.g., cells E9+E11+E13) and DPBS (e.g., cell F9

) needed.

CRITICAL Prepare fresh the day of

transfection. Re-measure plasmid DNA concentrations

immediately prior to

use; multiple

freeze/thaw cycles may cause DNA degradation.

SAN digestion buffer

Add 29.22 g of NaCl, 4.85 g of Tris base, and 952 mg of MgCl

to a 1 L

bottle of WFI water and shake to mix. Filter sterilize and store at RT for up to several months.

The resulting SAN digestion buffer should have a final pH of 9.5-10.0 and a final concentration

of 500 mM NaCl, 40 mM Tris base, and 10 mM MgCl

SAN + SAN digestion buffer

Add 100 U of SAN per ml of SAN

digestion buffer; pipet to mix.

CRITICAL

Prepare fresh prior to use.

40% (w/v) PEG stock solution

Decant approximately 500 ml of WFI water into a 500 ml sterile

bottle for later use. Add 146.1 g of NaCl

to the remaining 500 ml bottle of WFI water and

shake/heat until dissolved. Once completely dissolved, add 400 g of PEG and heat at 37 ̊C for

several hours to overnight. Add reserved WFI water to a total volume of 1 L. Filter sterilize and

store at RT for up to several months. The resulting stock solution should have a final

concentration of 2.5 M NaCl and 40% (w/v) PEG. CRITICAL

Prepare in advance. To expedite

the procedure, heat the solution at 65 ̊C until the PEG is dissolved. The solution will appear

tur

bid but no flecks of PEG should remain; the mixture will become clear upon cooling.

CRITICAL

Pre-wet the entire filter surface with a minimal volume of water prior to adding the

solution. This solution is extremely viscous and will take 1-2 h to filter.

DPBS +

high salt

Add 29.22 g of NaCl, 93.2 mg of KCl, and 47.6 mg of MgCl

to a 500 ml

bottle of DPBS and shake to mix. Filter sterilize and store at RT for up to several months. The

resulting buffer should have a final concentration of 1 M NaCl (in addition to the salt in the

DPBS), 2.5 mM KCl, and 1 mM MgCl

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

DPBS + low salt

Add 2.92 g of NaCl, 93.2 mg of KCl, and 47.6 mg of MgCl

to a 500 ml bottle

of DPBS and shake to mix. Filter sterilize and store at RT for up to several months. The

resulting buffer should have a final concentration of 100 mM NaCl (in addition to the salt in the

DPBS), 2.5 mM KCl, and 1 mM MgCl

Iodixanol density step solutions (15%, 25%, 40%, and 60% (w/v) iodixanol)

For each step,

add iodixanol, DPBS + high salt or DPBS + low

salt, and phenol red (if applicable) to a 50 ml

conical centrifuge tube. Briefly invert or vortex to mix. Use

Supplementary Table 3

determine the volumes of each reagent needed. The 25% and 60% steps contain phenol red,

which turns the solutions red and yellow, respectively, and facilitates clear demarcation of the

gradient boundaries (

Fig. 7

CRITICAL

Prepare fresh the day of AAV purification. Alternatively,

prepare up to 1 d in advance; store under sterile conditions at RT and protect from light. Do not

pour the density gradients until Step 16.

1 M Tris-Cl stock solution

Pipet 80 ml of Ultrapure or WFI water into a 250 ml sterile bottle.

Add 12.11 g of Tris base and 7 ml of concentrated HCl and shake to mix; fine adjust the pH to

7.5 by adding more concentrated HCl. Add water to a total volume of 100 ml. Filter sterilize and

store at RT for up to several months.

DNAse digestion buffer

Decant 250 ml of Ultrapure water into a 250 ml sterile bottle. Add 55.5

mg of CaCl

, 2.5 ml of 1 M Tris-Cl stock sol

ution, and 238 mg of MgCl

and shake to mix. Filter

sterilize and store at RT for up to several months. The resulting buffer should have a final

concentration of 2 mM CaCl

, 10 mM Tris

-Cl, and 10 mM MgCl

DNAse I + DNAse digestion buffer

Add 50 U of DNAse I per ml of digestion buffer; pipet to

mix.

CRITICAL Prepare fresh prior to use.

Proteinase K solution

Decant 250 ml of Ultrapure water into a 250 ml sterile bottle. Add 14.61

g of NaCl and shake to mix. Add 2.5 g of

-lauroylsarcosine sodium salt to

the mixture and

gently swirl to mix;

-lauroylsarcosine

sodium salt is a surfactant and will generate bubbles

during vigorous mixing. Filter sterilize and store at RT for up to several months. The resulting

solution should have a final concentration of 1 M NaCl and 1% (w/v)

-lauroylsarcosine sodium

salt.

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;

Proteinase K + proteinase K solution

Add 100 μg of proteinase K per ml of solution; pipet to

mix.

CRITICAL Prepare fresh prior to use.

DNA standard stock

Set up a single 50 μl restriction digest reaction; use 60-80 U (3-4 μl) of

ScaI (or other suitable enzyme) to linearize 20 μg of the plasmid DNA containing the target

sequence. Run a small amount of the reaction on an agarose gel to ensure complete digestion.

Purify the reaction using two DNA clean-up columns. Measure the DNA concentration (ng/μl)

using a spectrophotometer. Dilute to approximately 5-10 x 10

single-

stranded (ss) DNA

molecules/μl and use the Qubit assay to verify the concentration (ng/μl). Divide into 20 μl

aliquots and freeze at -

20 ̊C for up to 1 year.

CRITICAL

Prior to preparing the standard, use

sequence editing and annotation software to confirm that the plasmid contains a single ScaI site

in the ampicillin resistance gene. Refer to ref.

and use

Supplementary Table 4

(cell B13)

calculate the number of ssDNA molecules in a given plasmid. We typically use pAAV-CAG-

mNeonGreen to prepare the standard; following restriction digest we dilute the linearized

plasmid to 10 ng/μl, which corresponds to 6.6 x 10

ssDNA molecules/μl.

DNA standard dilutions

Prepare three sets of 8 (1:10) serial dilutions of the DNA standard

stock. For each set, begin by pipetting 5 μl of the standard into 45 μl of Ultrapure water

(standard #8). Mix by pipetting and proceed with the 7 remaining dilutions (standard #7 to

standard #1). The final concentrations of the standard dilutions should range from 5-10 x 10

(standard #8) to 5-10 x 10

(standard #1) ssDNA molecules/μl. CRITICAL

Prepare fresh in

DNA/RNA LoBind microcentrifuge tubes immediately prior to use; at low concentrations, the

linearized DNA is prone to

degradation and/or sticking to the walls of the tube

. One 20 μl

aliquot of the DNA standard stock will provide enough DNA for preparing the dilutions and

verifying the concentration via the Qubit assay prior to qPCR.

qPCR master mix

Prepare a qPCR master mix for the total number of reactions (i.e., wells)

needed. One reaction requires 12.5 μl of SYBR green master mix, 9.5 μl of Ultrapure water, and

0.5 μl of each primer (from a 2.5 μM stock concentration), for a total of 23 μl/well. Briefly vortex

to m

ix.

CRITICAL

Prepare fresh prior to use.

-------------------------------------------------------------------------------------------------------------------------------

EQUIPMENT SETUP

Clamp setup for AAV purification

Attach the rod to the support stand. Secure the clamp

approximately 25-30 cm above the stand (

Fig. 7f

The copyright holder for this preprint (which was not

http://dx.doi.org/10.1101/246405

doi:

bioRxiv preprint first posted online Jan. 11, 2018;