A novel subset of enteric neurons revealed by
ptf1a
:GFP in the
developing zebrafish enteric nervous system
Rosa A. Uribe
1
,
Tiffany Gu
1
, and
Marianne E. Bronner
1,*
1
Division of Biology and Biological Engineering, California Institute of Technology, Pasadena CA,
91125, USA
Abstract
The enteric nervous system, the largest division of the peripheral nervous system, is derived from
vagal neural crest cells that invade and populate the entire length of the gut to form diverse
neuronal subtypes. Here, we identify a novel population of neurons within the enteric nervous
system of zebrafish larvae that express the transgenic marker
ptf1a
:GFP within the midgut.
Genetic lineage analysis reveals that enteric
ptf1a
:GFP
+
cells are derived from the neural crest and
that most
ptf1a
:GFP
+
neurons express the neurotransmitter 5HT, demonstrating that they are
serotonergic. This transgenic line, Tg(
ptf1a
:GFP), provides a novel neuronal marker for a
subpopulation of neurons within the enteric nervous system, and highlights the possibility that
Ptf1a may act as an important transcription factor for enteric neuron development.
Keywords
serotonergic neuron; ptf1a; enteric nervous system; zebrafish
Introduction
The enteric nervous system (ENS) is comprised of interconnecting ganglia within the
myenteric and submucosal plexuses that run along the gut wall (
Bornstein et al., 1984
). The
ENS regulates gastrointestinal motility and, as the largest portion of the peripheral nervous
system, is often referred to as the “second brain” (
Furness, 2006
). The ENS is largely
derived from the “vagal” neural crest that arises from the dorsal neural tube in the post-otic
region (
LeDouarin and Teillet, 1973
;
Anderson et al., 2006
). Vagal neural crest cells migrate
away from the neural tube, moving ventrally toward the anterior foregut. After entering the
foregut, they change direction and begin migrating caudally such that they eventually
populate the entire gut, a migration process that takes days and is the longest of any
embryonic cell migration. Once reaching their final destinations, enteric neural crest (ENC)
differentiate into a diverse array of enteric neurons and glial cells along the entire length of
the gut (
Furness, 2006
;
Sasselli et al., 2012
). Because improper neural crest development
gives rise to developmental defects such as Hirschsprung’s disease (colonic aganglionosis)
(Bergeron et al., 2012), there has been great interest in understanding the migration,
specification and differentiation of enteric neural crest.
*
Corresponding author: Bronner ME, mbronner@caltech.edu.
HHS Public Access
Author manuscript
Genesis
. Author manuscript; available in PMC 2017 March 01.
Published in final edited form as:
Genesis
. 2016 March ; 54(3): 123–128. doi:10.1002/dvg.22927.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
Although recent studies have identified various neurotransmitter markers of terminally
differentiated enteric neuron subtypes within the ENS (
Uyttebroek et al. 2010
; rev. in
Sasselli et al., 2012
), much less is known about the transcription factors that mediate
terminal differentiation towards a particular neuron lineage. Nonetheless, some experiments
have shed light on this issue. For example, a null allele of
Ascl1
, a basic helix-loop-helix
(bHLH) transcription factor, results in a complete loss of all serotonergic neurons from the
ENS, demonstrating its requirement in differentiation of this enteric neuron subtype
(
Blaugrund et al. 1996
). Analogously, inactivation of the bHLH transcription factor
Hand2
in neural crest cells leads to disrupted ganglia patterning and selective loss of VIP
+
neurons,
indicating its importance in differentiation of peptidergic enteric neurons in the mouse gut
(
Hendershot et al. 2007
). However, understanding of the transcription factor code
responsible for enteric neuron subtype specification and terminal differentiation remains
limited. Accordingly, identification of novel factors expressed in the developing ENS will
highlight candidate genes that may be involved in these processes.
Pancreas specific transcription factor 1a,
ptf1a
, is expressed in the developing zebrafish
pancreas (
Lin et al., 2004
;
Zecchin et al., 2004
), retina (
Jusuf and Harris, 2009
) and
cerebellum (
Kani et al., 2010
) during embryonic development. Ptf1a plays a critical role in
zebrafish ventral pancreas specification and exocrine pancreas development (
Lin et al.,
2004
;
Zecchin et al., 2004
;
Dong et al., 2008
), as well as functioning during inhibitory
neuron subtype differentiation in the retina (
Dullin et al., 2007
;
Fujitani et al., 2006
),
cerebellum (
Hoshino et al., 2005
). Given the essential roles of Ptf1a in the subtype
specification of various neuron types within the nervous system, we sought to examine if it
was also present within the developing ENS. Here, our results using the transgenic fish line
Tg(
ptf1a
:GFP) reveal that
ptf1a
is expressed in a subset of neurons in the developing ENS of
zebrafish larvae. Thus, these data identify Ptf1a as a novel neuronal marker in the
developing ENS.
Results
The transgenic line Tg(ptf1a:GFP) labels a subset of ENS neurons during larval stages of
zebrafish development
The transgenic line Tg(
ptf1a
:GFP) previously has been shown to mark cells that express
ptf1a in vivo
(
Godinho et al., 2007
;
Jusuf and Harris, 2009
;
Kani et al., 2010
). To examine if
cells that express
ptf1a
are present in the developing ENS,
ptf1a
:GFP
+
larvae were
examined from 3 to 6 days post fertilization (dpf), the time during which terminal
differentiation commences in the developing zebrafish ENS. Whole mount confocal
microscopy revealed that
ptf1a
:GFP
+
cells were first present at 4 dpf in the midgut (Fig.
1A), and persisted at 5 dpf and 6 dpf (Fig. 1B,C), with a few
ptf1a
:GFP
+
cells also seen in
the intestinal bulb (foregut) by 6 dpf (Fig. 1F). There was an average of 13
ptf1a
:GFP
+
cells
in the midgut at 4 dpf, 19 cells at 4 dpf and 21 cells at 6 dpf (Fig. 1D). GFP
+
cells were also
present in other regions of the embryo, such as the pancreas (Fig. 1F). In order to detect
endogenous
ptf1a
transcripts in the developing ENS, we performed in whole mount
in situ
hybridization. Consistent with the distribution of cells observed in the transgenic line, this
Uribe et al.
Page 2
Genesis
. Author manuscript; available in PMC 2017 March 01.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
analysis revealed the presence of
ptf1a
transcripts in the developing brain, pancreas and the
midgut, but not the hindgut, at 6 dpf (Fig. 1G,H).
To assess if the
ptf1a
:GFP
+
cells observed in the gut were neurons, we performed double
whole mount immunochemistry against GFP and pan-neuronal markers, Hu or acetylated
tubulin. At 4 dpf, confocal images revealed that a minority of
ptf1a
:GFP
+
cells co-localized
with Hu (Fig. 1A
′
,A
′′
), or with acetylated tubulin, as seen in both static confocal images and
a 3D rendering movie (Fig. 2A
′
,A
′′
; Supporting Information Movie 1). However, at 5 and 6
dpf, a majority of
ptf1a
:GFP
+
cells co-localized with Hu (Fig. 1B
′
,B
′′
-C
′
,C
′′
; Supporting
Information Movie 2) and acetylated tubulin (Fig. 2B
′
,B
′′
-C
′
,C
′′
), revealing their neuronal
identity. At 6 dpf, analysis of confocal stack projections along the z-axis revealed that the
ptf1a
:GFP
+
cells were located in a concentric pattern along the outer layer of the gut tube,
co-localizing with Hu (Fig. 1E). These data indicate that
ptf1a
:GFP
+
cells are present within
the gut prior to their terminal differentiation into neurons at 4 dpf, and that its expression is
maintained in differentiated neurons at 5 and 6 dpf. At 5 dpf, quantification revealed that an
average of 28% of Hu
+
neurons were
ptf1a
:GFP
+
in the midgut, while at 6 dpf 36% were
ptf1a
:GFP
+
(Fig. 1I), demonstrating that
ptf1a
is not expressed in all enteric neurons, but
rather in a subset of neurons.
Previously, it has been shown that ~30% of midgut neurons contain the neurotransmitter
serotonin (5HT) at 5 dpf (
Uyttebroek et al., 2010
). In order to determine whether
ptf1a
:GFP
+
neurons in the midgut were also 5HT
+
, we performed double immunostaining of
ptf1a
:GFP
larvae with antibodies against GFP and 5HT. At 5 dpf, an average of 97% of
ptf1a
:GFP
+
cells were 5HT
+
(Fig. 3A–A
′′
), indicating that the
ptf1a
:GFP
+
neuron population are largely
serotoninergic neurons within the larval midgut.
ptf1a:GFP+ cells in the developing ENS are derived from the neural crest
ptf1a
is expressed in the developing pancreas, where it plays key roles in regulating pancreas
formation (
Lin et al., 2004
). On the other hand, in the brain and retina, it is expressed in
differentiating neuron subtypes (
Dullin et al., 2007
;
Kani et al., 2010
) during neurogenesis
and retinogenesis, respectively. To date,
ptf1a
expression has not been described in neural
crest derived structures. To ascertain whether the
ptf1a
:GFP
+
neurons observed in the gut
were neural crest derived, we crossed Tg(
ptf1a
:GFP) fish with the
Tg(-
4725sox10:Cre;elf1a
:loxp-GFP-loxp-dsRedpA) line, which permanently labels neural
crest cells and all of their derivatives by ubiquitous expression of the dsRed fluorescent
protein (
Rodrigues et al., 2012
), allowing for lineage analysis
in vivo
. In live embryos at 5
dpf, 100% of
ptf1a
:GFP
+
cells in the gut were also positive for dsRed, indicating that they
were indeed derived from the neural crest cells (Fig. 3B–B
′′
).
Discussion
In this study we report the presence of a novel population of
ptf1a
:GFP
+
neurons located
within the midgut of the developing ENS of zebrafish larvae, a majority of which are
serotonergic. This is the first report describing
ptf1a
expression within the ENS in any
organism. This line can be used as an
in vivo
marker of differentiating and terminally
differentiated neurons, thus serving as a useful tool for developmental studies of the ENS.
Uribe et al.
Page 3
Genesis
. Author manuscript; available in PMC 2017 March 01.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
During zebrafish ENS differentiation, enteric progenitors migrate caudally along the gut
tube, within the gut mesenchyme, fully populating the gut by 3 dpf. Subsequently, these
enteric progenitors undergo extensive proliferation in order to generate thousands of enteric
neurons in the appropriate proportions and in precise locations within the adult zebrafish gut
(
Uyttebroek et al., 2010
). That we did not detect
ptf1a
:GFP
+
cells prior to 4 dpf indicates
that it is activated after the initial neural crest invasion of the gut, suggesting a possible later
role during enteric neuroblast proliferation and/or terminal differentiation. In support of this
idea, we found that
ptf1a
:GFP
+
cells in the gut co-localized with the neuronal markers Hu
and acetylated tubulin, as well as largely co-localizing with the neurotransmitter serotonin,
5HT. During zebrafish ENS development, serotonergic neurons encompass between ~25–
30% of total neurons in the larval gut by 5 dpf (
Uyttebroek et al., 2010
). In adult fish, these
proportions are maintained in the proximal gut and midgut, while in the hindgut the
proportion reduces sharply to ~10% of total neurons (
Uyttebroek et al., 2010
). Interestingly,
within the developing Xenopus retina, Ptf1a regulates the balance of inner nuclear layer
neuron subtypes, specifically controlling the number of GABAergic interneurons born
during retinogenesis (
Dullin et al., 2007
). Ectopic expression of
ptf1a
was sufficient to
increase the number of 5HT
+
neurons, while Ptf1a loss decreased the number of 5HT
+
neurons within the retina (
Dullin et al., 2007
), suggesting an important role for Ptf1a in the
allocation or differentiation of serotonergic neuron subtypes. In conjunction with these
previous studies, our discovery of the presence of
ptf1a
:GFP
+
/5HT
+
cells in the gut suggests
that Ptf1a may play similar roles. Future studies aimed at further investigating the role of
Ptf1a in development of enteric neuron subtypes, as well as its functional regulation within
the ENS, will provide novel insight into the mechanisms underlying neurogenesis within the
peripheral nervous system.
Materials and Methods
Zebrafish maintenance and fish lines
Zebrafish (
danio rerio
) were maintained at 28.5°C on a 13-hour light/11 hour dark cycle.
Animals were treated in accordance with California Institute of Technology IACUC
provisions. The Tg(
ptf1a
:GFP) line (
Godinho et al., 2007
) and/or
Tg(-
4725sox10:Cre;elf1a
:loxp-GFP-loxp-dsRedpA) line (
Rodrigues et al., 2012
) was used
for all experiments.
in situ
hybridization
Hybridizations were performed as previously described (
Uribe and Gross, 2010
), with the
addition of a 20 minute Collagenase type 1A (Sigma C9891) digestion (1 mg/mL) prior to
Proteinase K digestion to facilitate penetration of the probe. To generate
ptf1a
probe, the
following primers were used to PCR amplify template containing a T7 polymerase site from
pCS2-ptf1a (
Zhang et al., 2012
), forward 5
′
CGACGATGACTTCTTTACGGACC 3
′
and
reverse 5
′
TAATACGACTCACTATAGGTTCCTCGGTGGCAAATGATG 3
′
, with the T7
site underlined. T7 polymerase was used to generate antisense probe.
Uribe et al.
Page 4
Genesis
. Author manuscript; available in PMC 2017 March 01.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
Whole mount immunochemistry
Larval fish at 4 dpf, 5 dpf and 6 dpf were fixed overnight at 4°C in 4% PFA, rinsed three
times in 1X PBS, incubated in 100% Methanol at −20°C for 1 hour and then rehydrated
step-wise into 1X PBS at room temperature. Larvae were then incubated in 100% acetone at
−20°C for 11 minutes, rinsed three times in 1X PBS, then digested at room temperature in
10 μg/mL Proteinase K for 45 min. (4 dpf), 55 min. (5 dpf) or for 65 min. (6 dpf). Larvae
were then rinsed three times in 1X PBS, fixed for 10 minutes in 4% PFA at room
temperature, rinsed 3 times in 1X PBS and then incubated in 5% Donkey serum block
diluted in 1X PBS-tween-20, supplemented with 1% DMSO (PBTD), for 3 hours. Embryos
were then incubated in either rabbit anti-GFP 1:500 (Life Technologies, A-11122), goat
anti-GFP 1:500 (Abcam, ab6673), mouse anti-HuC/D (Hu) 1:200 (Invitrogen), mouse anti-
Acetylated tubulin 1:1000 (Sigma, T6793) or rabbit anti-5HT 1:1000 (Immunostar)
overnight at 4°C. Embryos were then washed out of primary antibody in 1X PBS-tween-20,
then incubated at room temperature in 1:700 secondary antibodies Invitrogen Alexa Fluor
Donkey anti-Rabbit 488, anti-Rabbit 647, anti-Goat 488 or Donkey anti-Mouse 594 for 3
hours at room temperature. Embryos were rinsed in 1X PBST and imaged in 75%
glycerol/1X PBS on a Zeiss 710 2-photon confocal microscope (Beckman Imaging Center,
Caltech).
Live imaging
Embryos positive for both Tg(
ptf1a
:GFP) and Tg(-
4725sox10:Cre;elf1a
:loxp-GFP-loxp-
dsRedpA) were mounted laterally in 1% low melt agarose dissolved in fish water
supplemented with 1X PTU and Tricaine anesthetic, in an imaging chamber. 20–80 micron
Z-stacks were acquired using a 20x objective on a Zeiss LSM 710 microscope. Z-stacks
were compiled and exported using Imaris Image Analysis software.
Supplementary Material
Refer to Web version on PubMed Central for supplementary material.
Acknowledgments
We thank Ryan Anderson (Indiana University School of Medicine) for sharing the Tg(
ptf1a
:GFP) line and Robert
Kelsh (University of Bath) for sharing the Tg(
-4725sox10:Cre;elf1a
:loxp-GFP-loxp-dsRedpA) line. We thank
Crystal Rogers and Stephen Green for helpful discussions, Yuk Fai Leung (Purdue University) for pCS2-ptf1a
construct and Martha Henderson and David Mayorga for fish care. Research was supported by grants from NIH
DE024157 to M.E.B., from NIH F32 HD080343 to R.A.U. and a Burroughs Wellcome Fund Postdoctoral
Enrichment Program Award to R.A.U.
Abbreviations
ENS
Enteric Nervous System
ENC
Enteric Neural Crest
References
Anderson RB, Stewart AL, Young HM. Phenotypes of neural-crest-derived cells in vagal and sacral
pathways. Cell Tissue Res. 2006; 323:11–25. [PubMed: 16133146]
Uribe et al.
Page 5
Genesis
. Author manuscript; available in PMC 2017 March 01.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
Bergeron KF, Silversides DW, Pilon N. The developmental genetics of Hirschsprung’s disease. Clin
Genet. 2013; 83(1):15–22. [PubMed: 23043324]
Blaugrund E, Pham TD, Tennyson Vm, Lo I, Sommer L, Anderson DJ, Gershon MD. Distinct
subpopulations of enteric neuronal progenitors defined by time of development, sympathoadrenal
lineage markers and Mash-1-dependence. Devel. 1996; 122:309–320.
Bornstein JC, Costa M, Furness JB, Lees GM. Electrophysiology and enkephalin immunoreactivity of
identified myenteric plexus neurones of guinea-pig small intestine. J Physiol. 1984; 351:313–325.
[PubMed: 6379150]
Dong PD, Provost E, Leach SD, Stainier DY. Graded levels of Ptf1a differentially regulate endocrine
and exocrine fates in the developing pancreas. Genes and Devel. 2008; 22(11):1445–1450.
[PubMed: 18519637]
Dullin JP, Locker M, Robach M, Henningfeld KA, Parain K, Afelik S, Pieler T, Perron M. Ptf1a
triggers GABAergic neuronal cell fates in the retina. BMC Dev Biol. 2007; 7:110. [PubMed:
17910758]
Fujitani Y, Fujitani S, Luo H, Qiu F, Burlison J, Long Q, Kawaguchi Y, Edlund H, MacDonald RJ,
Furukawa T, Fujikado T, Magnuson MA, Xiang M, Wright CV. Ptf1a determines horizontal and
amacrine cell fates during mouse retinal development. Devel. 2006; 133:4439–50.
Furness, JB. The Enteric Nervous System. Blackwell Publishing, Inc; 2006.
Godinho L, Williams PR, Claassen Y, Provost E, Leach SD, Kamermans M, Wong RO. Nonapical
symmetric divisions underlie horizontal cell layer formation in the developing retina in vivo.
Neuron. 2007; 56(4):597–603. [PubMed: 18031679]
Hendershot TJ, Liu H, Sarkar AA, Giovannucci DR, Clouthier DE, Abe M, Howard MJ. Expression of
Hand2 is sufficient for neurogenesis and cell type-specific gene expression in the enteric nervous
system. Dev Dyn. 2007; 236:93–105. [PubMed: 17075884]
Hoshino M, Nakamura S, Mori K, Kawauchi T, Terao M, Nishimura YV, Fukuda A, Fuse T, Matsuo
N, Sone M, Watanabe M, Bito H, Terashima T, Wright CV, Kawaguchi Y, Nakao K, Nabeshima
Y. Ptf1a, a bHLH transcriptional gene, defines GABAergic neuronal fates in cerebellum. Neuron.
2005; 47:201–13. [PubMed: 16039563]
Jusuf PR, Harris WA. Ptf1a is expressed transiently in all types of amacrine cells in the embryonic
zebrafish retina. Neural Devel. 2009; 4:34. [PubMed: 19732413]
Kani S, Bae YK, Shimizu T, Tanabe K, Satou C, Parsons MJ, Scott E, Higashijima SI, Hibi M.
Proneural gene-linked neurogenesis in zebrafish cerebellum. Devel Biol. 2010; 343(1–2):1–17.
[PubMed: 20388506]
Le Douarin NM, Teillet MA. The migration of neural crest cells to the wall of the digestive tract in
avian embryo. J Embryol Exp Morphol. 1973; 30(1):31–48. [PubMed: 4729950]
Lin JW, Biankin AV, Horb ME, Ghosh B, Prasad NB, Yee NS, Pack MA, Leach SD. Differential
requirement for ptf1a in endocrine and exocrine lineages of developing zebrafish pancreas. Devel
Biol. 2004; 270(2):474–486. [PubMed: 15183727]
Rodrigues FS, Doughton G, Yang B, Kelsh RN. A novel transgenic line using the Cre-lox system to
allow permanent lineage labelling of the zebrafish neural crest. Genesis. 2012; 50(10):750–757.
[PubMed: 22522888]
Sasselli V, Pachnis V, Burns AJ. The enteric nervous system. Dev Biol. 2012; 366:64–73. [PubMed:
22290331]
Uribe RA, Gross JM. Id2a influences neuron and glia formation in the zebrafish retina by modulating
retinoblast cell cycle kinetics. Devel. 2010; 137(22):3763–3774.
Uyttebroek L, Shepherd IT, Harrisson F, Hubens G, Blust R, Timmermans JP, Van Nassauw L.
Neurochemical coding of enteric neurons in adult and embryonic zebrafish (Danio rerio). J Comp
Neurol. 2010; 518(21):4419–4438. [PubMed: 20853514]
Zecchin E, Mavropoulos A, Devos N, Filippi A, Tiso N, Meyer D, Peers B, Bortolussi M, Argenton F.
Evolutionary conserved role of ptf1a in the specification of exocrine pancreatic fates. Devel Biol.
2004; 268(1):174–184. [PubMed: 15031114]
Zhang Y, Yang Y, Trujillo C, Zhong W, Leung YF. The Expression of irx7 in the Inner Nuclear Layer
of Zebrafish Retina Is Essential for a Proper Retinal Development and Lamination. PLoS One.
2012; 7(4):e36145. [PubMed: 22540019]
Uribe et al.
Page 6
Genesis
. Author manuscript; available in PMC 2017 March 01.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
Figure 1. The transgenic line Tg(
ptf1a
:GFP) marks a subset of neurons within the larval ENS
Maximum projection confocal stacks at (A–A
′′
) 4 dpf, (B–B
′′
) 5 dpf and (C–C
′′
) 6 dpf
depicting
ptf1a
:GFP
+
and Hu
+
cells within the midgut (dashed lines), scale bar: 70 microns,
for A–C. (D) Bar graph illustrating total number of
ptf1a
:GFP
+
cells in the gut from 4 dpf to
6 dpf, error bars represent s.e.m., n=6. (E) Maximum intensity confocal projection along the
z-axis reveals that
ptf1a
:GFP
+
/Hu
+
cells co-localize in a concentric pattern along the gut
tube at 6 dpf, scale bar: 100 microns. (F) Lateral view of a 6 dpf
ptf1a
:GFP
+
larval fish.
(G,H) Ventrolateral view following whole mount
in situ
hybridization against
ptf1a
reveals
that
ptf1a
localizes to the brain, pancreas and midgut of 6 dpf larvae. (I) Bar graph
illustrating the percentage of total Hu
+
neurons that are
ptf1a
:GFP
+
in the midgut at 5 dpf
and 6 dpf, error bars represent s.e.m., n= 6. Int. bulb-intestinal bulb.
Uribe et al.
Page 7
Genesis
. Author manuscript; available in PMC 2017 March 01.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
Figure 2.
ptf1a
:GFP
+
cells co-localize with the neuronal marker acetylated tubulin in the gut
Maximum projection confocal stacks at (A–A
′′
) 4 dpf, (B–B
′′
) 5 dpf and (C–C
′′
) 6 dpf
depicting
ptf1a
:GFP
+
and Acetylated tubulin
+
cells within the midgut (dashed lines), scale
bar: 70 microns.
Uribe et al.
Page 8
Genesis
. Author manuscript; available in PMC 2017 March 01.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
Figure 3.
ptf1a
:GFP cells are largely serotonergic enteric neurons that are derived from the
neural crest
Maximum projection confocal stack of the midgut (A–A
′′
) reveal that
ptf1a
:GFP
+
cells co-
localize with the neurotransmitter 5HT at 6 dpf. (B–B
′′
) Images of live triple transgenic
larval fish,
ptf1a
:GFP;-
4725sox10:Cre;elf1a
:loxp-GFP-loxp-dsRedpA, shows that
ptf1a
:GFP
+
cells are neural crest derived. Scale bar: 70 microns.
Uribe et al.
Page 9
Genesis
. Author manuscript; available in PMC 2017 March 01.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript