of 15
The epigenetic modifier DNMT3A is necessary for proper otic
placode formation
Daniela Roellig
and
Marianne E. Bronner
Division of Biology and Biological Engineering, California Institute of Technology, Pasadena, CA
91125 USA
Abstract
Cranial placodes are thickenings in the ectoderm that give rise to sensory organs and peripheral
ganglia of the vertebrate head. At gastrula and neurula stages, placodal precursors are intermingled
in the neural plate border with future neural and neural crest cells. Here, we show that the
epigenetic modifier, DNA methyl transferase (DNMT) 3A, expressed in the neural plate border
region, influences development of the otic placode which will contribute to the ear. DNMT3A is
expressed in the presumptive otic region at gastrula through neurula stages and later in the otic
placode itself. Whereas neural plate border and non-neural ectoderm markers Erni, Dlx5, Msx1
and Six1 are unaltered, DNMT3A loss of function leads to early reduction in the expression of the
key otic placode specifier genes Pax2 and Gbx2 and later otic markers Sox10 and Soho1.
Reduction of Gbx2 was first observed at HH7, well before loss of other otic markers. Later, this
translates to significant reduction in the size of the otic vesicle. Based on these results, we propose
that DNMT3A is important for enabling the activation of Gbx2 expression, necessary for normal
development of the inner ear.
Keywords
otic; placode; DNMT3A; Gbx2; Pax2
Introduction
Cranial ectodermal placodes are thickened epithelial structures in the head ectoderm of the
early embryo that contribute to sensory organs (ear, eye and olfactory epithelium) and major
ganglia of the head (trigeminal, epibranchial). All placode precursors arise at gastrula and
neurula stages from the neural plate border region, between prospective neural and non-
neural ectoderm, where they are intermingled with future neural and neural crest cells
mbronner@caltech.edu (corresponding author).
roellig@caltech.edu
Publisher's Disclaimer:
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our
customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of
the resulting proof before it is published in its final citable form. Please note that during the production process errors may be
discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Conflict of Interest statement. None declared.
HHS Public Access
Author manuscript
Dev Biol
. Author manuscript; available in PMC 2017 March 15.
Published in final edited form as:
Dev Biol
. 2016 March 15; 411(2): 294–300. doi:10.1016/j.ydbio.2016.01.034.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
(
Bhattacharyya and Bronner-Fraser, 2004
;
Meulemans and Bronner-Fraser, 2004
;
Streit and
Stern, 1999
).
Temporal and spatial integration of different signals and transcription factors defines the
neural plate border territory. At neurula stages, mesenchymal FGF signaling induces Wnt8a
and FGF signaling in neural ectoderm that defines the pre-placodal region in the non-neural
ectoderm. Several transcription factors characteristic of this region are induced, including
Dlx family genes, Erni, Sox3, Msx1 and Foxi genes (
Ekker et al., 1992
;
Groves and
Bronner-Fraser, 2000
;
Liu et al., 2003
;
Solomon and Fritz, 2002
). At late neurula stages,
FGF, BMP and WNT signaling are thought to segregate fates within the border area by
regulating a set of transcription factors including Pax7, Snai2, FoxD3, Sox10, Six1/4 and
Eya1/2. Subsequently, on the basal side, FGF induces otic invagination (
Ladher et al., 2010
;
Streit, 2007
).
This complex network of signaling and transcription factors requires tight spatiotemporal
regulation, as might be provided by epigenetic modifiers. Recently, we showed that DNA
methylation by DNMT3A promotes neural crest fate while inhibiting neural fate (
Hu et al.,
2012
), suggesting a possible role for these epigenetic factors in regulating cell fate decisions
at the neural plate border. DNA methyltransferases function by recognizing CpG islands and
catalyzing the transfer of a methyl group to DNA on the C5 position of cytosine (
Cheng and
Blumenthal, 2008
). Methylation of CpG sites in the promoter region of a gene is thought to
inhibit its expression, as shown in cancer and stem cells (
Altun et al., 2010
;
Miranda and
Jones, 2007
;
Momparler and Bovenzi, 2000
). In some cases, DNMTs are also thought to
activate gene expression by directly methylating gene bodies (
Ball et al., 2009
;
Lister et al.,
2009
) or by inhibiting binding of repressors via methylation (
Bahar Halpern et al., 2014
).
Since DNMT3A is broadly expressed in the neural plate border territory from which not
only neural crest but also placodal precursors arise, this raised the possibility that it may be
required for normal placode development. Here, we test the function of DNMT3A on
formation of the otic placode and early development of the ear. The results show that loss of
DNMT3A causes loss of early ear markers Gbx2 and Pax2 as well as later otic markers
Sox10 and Soho1. This leads to later defects in the otic placode, suggesting that epigenetic
regulation is critical for normal ear development.
Results
DNMT3A is expressed in presumptive otic region and otic placode
As a first step in examining the possible relationship between DNMT3A and placode
development, we performed in situ hybridization at gastrula through neurula stages to
determine its expression pattern relative to that of ear precursors (dashed lines in Fig. 1). We
find that DNMT3A is expressed in the neural plate border at HH4 (Fig. 1A). While high
expression continues in the neural plate, as previously shown (
Hu et al., 2012
), DNMT3A
also is expressed laterally in the presumptive ear territory at HH6 (Fig. 1B) and HH8 (Fig.
1C). Transverse sections reveal that expression is elevated in the ectodermal layer at the
stages examined (Fig. 1A’, B’, C’).
Roellig and Bronner
Page 2
Dev Biol
. Author manuscript; available in PMC 2017 March 15.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
Inhibition of DNMT3A reduces the expression of otic placode markers and the size of the
otic vesicle
To assess the functional importance of DNMT3A, we performed loss of function
experiments using a translational blocking morpholino (MO) (
Hu et al., 2012
). The
morpholino was electroporated into the gastrula stage embryo at HH4 either targeting one
half of the head region or the lateral placode-forming region of the embryo. The effects on
placode development were examined at subsequent developmental stages by in situ
hybridization to determine effects on otic marker genes.
Knock down of DNMT3A caused a down-regulation of the otic placode marker Gbx2 very
early in the process of placode specification, by HH7 (Fig. 2A, A’). At HH9 Gbx2 was
markedly down-regulated in the DNMT3A MO treated side (Fig. 2B, B’, D). Similar results
were obtained for Pax2, another otic placode marker, at HH10 (Fig. 2E, E’, F).
We also noted down-regulation of Sox10 at HH11 after initiation of its expression in the otic
placode (Fig. S1A, B), similar to its effects on Sox10 expression in the neural crest (
Hu et
al., 2012
), and otic expression of Soho1 at HH12 (Fig S1C) upon DNMT3A MO treatment.
Interestingly, DNMT3A MO knockdown did not alter the expression of the epidermal
marker Ck19 in the otic region (Fig 2G, G’).
The early effects on gene expression led to subsequent defects in otic development as
evidenced by a reduced size of the otic vesicle (Fig. 2C). By the time that the morpholino
was introduced at HH4, DNMT3A is already expressed. Thus, it is likely that some
DNMT3A activity persists in the treated embryos due to perdurance of already translated
protein and stability of resulting DNA methylation, likely explaining the semi-penetrant
effects on otic vesicle formation.
To control for the specificity of the DNMT3A morpholino and demonstrate that the
observed phenotype was not due to off-target effects, we coelectroporated the DNMT3A
MO with a construct encoding ubiquitously expressed DNMT3A. This resulted in a marked
rescue of the loss of function phenotype and restored Gbx2 expression (Fig. 3A, B, D).
Over-expression of the DNMT3A rescue construct alone did not alter Gbx2 expression (Fig.
3C).
Altogether these results suggest that DNMT3A is critical for epigenetic regulation of the otic
placode formation and normal early development of the inner ear.
DNMT3A knockdown does not alter expression of early neural plate border and non-neural
ectoderm markers
Because DNMT3A expression is already present at HH4, it is possible that loss of Gbx2 and
Pax2 in the otic domain might be secondary to abnormalities in the formation of the neural
plate border. To examine this possibility, we tested whether loss of DNMT3A influenced
expression of genes important for neural plate border specification. The results show that
expression of key early neural plate border markers Erni and Msx1 (Fig. 4 A, B) and non-
neural ectoderm markers Dlx5 and Six1 (Fig. 4 C, D) was unaltered when comparing the
DNMT3A-MO injected side with the contralateral control MO injected side of the same
Roellig and Bronner
Page 3
Dev Biol
. Author manuscript; available in PMC 2017 March 15.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
embryo. This suggests that loss of the otic fate is not due to a secondary effect on neural
plate border formation.
Mutual repression between Gbx2 and Otx2 has been reported in sensory placode formation
(
Steventon et al., 2012
). Therefore we also tested whether DNMT3A knock down causes an
expansion of Otx2 expression at the expense of Gbx2. However, the results revealed no
change in Otx2 expression (Fig. 5A). Similarly, expression of Sox2 and Sox3, previously
shown to be direct targets of DNMT3A during neural crest formation (
Hu et al., 2012
), were
unaffected in the otic placodal domain at HH9 (Fig. 5B, C).
FGF signaling from tissues basal to the otic area has been shown to be important for proper
otic invagination (
Ladher et al., 2010
;
Streit, 2007
). Therefore we checked the expression of
a downstream effector of FGF signaling, Erm, to investigate whether the pre-placodal
ectoderm is receiving FGF signals in the morphant embryos. Additionally, since canonical
WNT signaling is important for Gbx2 expression (
Li et al., 2009
), we checked expression of
a downstream repressor, Tcf3 (
Cole et al., 2008
;
Kim et al., 2000
;
Merrill et al., 2004
;
Yi et
al., 2011
). We picked these markers, because they are both expressed in the region of
interest at the time when we observe reduced Gbx2 expression upon DNMT3A knock down.
However, both markers, Tcf3 and Erm, were unaltered upon DNMT3A knock down (Fig.
S2).
Taken together, these results show that loss of DNMT3A selectively effects formation of the
otic placode domain without influencing neural plate border formation.
Discussion
DNMT3s are essential for de novo methylation during early developmental stages (
Okano et
al., 1999
). They play important roles in cancer and disease, but also normal aspects of
mammalian development (
Ehrlich et al., 2008
;
Linhart et al., 2007
). Many tumor suppressor
genes are silenced in a variety of human cancer cells by promoter methylation whereas some
oncogenes are activated by hypomethylation. In tumor cells, excessive levels of DNMT3B
bind to the promoter region of E-cadherin, reducing adhesion and aggregation, which
correlates with increased metastasis (
Kwon et al., 2010
). Several studies demonstrate a role
of DNMT3 methyltransferases in development. Single DNMT3B null embryos have rostral
neural tube defects and growth impairment, whereas DNMT3A and 3B double mutants are
embryonic lethal (
Okano et al., 1999
).
Interestingly, alterations in DNA methylation have also been associated with several
syndromes that cause hearing related problems (
Provenzano and Domann, 2007
). For
instance DNA hypomethylation has been related with hearing loss in patients with ICF
syndrome (immunodeficiency, centromere instability, facial anomalies) (
Robertson et al.,
1999
;
Xie et al., 1999
). In this disease, large parts of several chromosomes remain
unmethylated, which leads to chromosomal rearrangements, thereby effecting gene
expression (
Jeanpierre et al., 1993
;
Stacey et al., 1995
). Hearing loss has also been reported
in patients with facioscapulohumeral muscular dystrophy (FSHD1). Deletions and
Roellig and Bronner
Page 4
Dev Biol
. Author manuscript; available in PMC 2017 March 15.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
hypomethylation in the D4Z4 array on chromosome 4 seem key events in this disease (
van
Overveld et al., 2003
).
These data suggest that DNMT3 methyltransferases have specificity to certain genes to
influence particular developmental processes during ear development. Here we show for the
first time an influence of DNMT3A on very early stages of inner ear development, during
the development of the otic placode.
Previous work from our lab has shown that DNMT3A is highly expressed in the neural plate
border at gastrula stages and, later on, is expressed in neural folds and neural crest cells (
Hu
et al., 2012
). Loss of functions experiments further revealed that epigenetic modifications
were crucial for neural versus neural crest cell fate decisions in the neural tube (
Hu et al.,
2012
), such that DNA methyltransferase DNMT3A promotes neural crest specification by
directly binding to and repressing the neural genes Sox2 and Sox3. In contrast, in the
developing ear, we find that Sox2 and Sox3 are neither expressed earlier nor is their
expression altered after DNMT3A loss in the otic area. This difference might be explained
by the possibility that DNMT3A cooperates with different cofactors in different tissues,
which would go in line with the late onset of Sox2, and Sox3 expression in the otic region
compared to the early neural tube expression of these two genes.
The present results show that, in addition to the neural plate border region, DNMT3A also is
expressed in the pre-placodal domain at gastrula stages and later at lower levels in the chick
otic placode domain. Selective loss of DNMT3A in the otic domain leads to loss of several
otic markers, Gbx2, Pax2, Sox10 and Soho1, and subsequent reduction of the otic vesicle.
This is in agreement with previous findings in mouse (
Okano et al., 1999
). Although the
authors did not focus on otic placode development in DNMT3A knockout mice, their data
suggest a reduction in otic vesicle size in DNMT3A
+/−
, but not DNMT3B
+/−
mice (
Okano et
al. 1999
, Fig. 3, compare D and H).
In general, DNMTs are thought to act via methylation of CpG islands in the promoter region
of genes, resulting in inhibition of gene expression. In contrast, the present data suggest that
DNMT3A acts as a positive regulator of Gbx2 and Pax2, either directly or indirectly. A
similar mechanism has been described for FoxA2 activation during endoderm development
(
Bahar Halpern et al., 2014
). This study hypothesized that in undifferentiated hESC-derived
early endoderm-stage cells, low DNA methylation of certain CpG islands enabled binding of
repressive proteins. Upon differentiation, DNA methylation of these CpG islands caused
loss of repressor binding, thus leading to activation of FoxA2.
We propose that a similar mechanism may be invoked in the otic placode, such that
DNMT3A methylation of CpG islands prevents binding of yet unknown repressors,
allowing the activation of otic marker expression. Accordingly to this model, in the presence
of DNMT3A, CpG islands in the putative repressor binding sites become methylated, thus
preventing repressor binding to the target gene. Loss of DNMT3A results in demethylation
of these repressor binding sites. In this state, the repressors bind and block target gene
expression (Fig. 5D).
Roellig and Bronner
Page 5
Dev Biol
. Author manuscript; available in PMC 2017 March 15.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
In summary, we have interrogated the function of DNMT3A in early ear development. Our
results place DNMT3A upstream of one of the earliest otic genes Gbx2 (
Hidalgo-Sanchez et
al., 2000
;
Paxton et al., 2010
). Establishing epigenetic regulation as a driver of otic specifier
expression provides important insights into how the chick inner ear is induced.
Methods
Embryos
Fertilized chicken eggs were incubated at 37°C to the desired stages.
In situ hybridization
Embryos were fixed with 4% paraformaldehyde, washed with PBS/0.1% Tween, dehydrated
in MeOH, and stored at −20°C. Whole-mount in situ hybridization was performed as
described (
Acloque et al., 2008
;
Wilkinson, 1992
). Dioxigenin-labeled RNA probes were
made from DNA plasmids or ESTs of DNMT3A, Dlx5, Erm, Erni, Gbx2, Msx1, Otx2,
Pax2, Six1, Sox2, Sox3, Sox10, Soho1, and. Tcf3. Embryos were cryo-sectioned at 20 mm.
Electroporation
Embryos were electroporated at HH 4–5 as described (
Sauka-Spengler and Barembaum,
2008
) using DNMT3AMO1 (over ATG codon) (TGGGTGTGTCACTGCTTTCCACCAT)
or DNMT3AMO2 (95 nucleotides upstream of ATG)
(CAGTGTCCCCACGGCGCTTCCTGCT) (
Hu et al., 2012
). The coding region of
DNMT3A (NM001024832.1) (
Hu et al., 2012
) was cloned into the pCI H2B-RFP vector
(
Betancur et al., 2010
) as rescue construct. For each embryo, 0.6-0.7 mM MO + 0.5 mg/mL
DNA was used for knockdown experiments, and 0.6 mM MO + 1-1.5 mg/mL DNA was
used for rescue experiments, except if stated otherwise in the text. The MO was targeted to
either half of the anterior side of the embryo or the presumptive otic region with five 50-
msec pulses of 5.2 V at 100-msec intervals. No phenotypic difference in the otic area was
observed between one and the other injection method. Electroporated embryos were
maintained in culture dishes with 1 mL of albumen at 37°C and then fixed.
Supplementary Material
Refer to Web version on PubMed Central for supplementary material.
Acknowledgements
We thank Bertrand Bénazéraf for helpful discussions and critical reading of the manuscript. This work was funded
by grants DC011577 and DE16459 from the NIH. DR was funded by the Deutsche Forschungsgemeinschaft (DFG;
RO 4334/1-1).
References
Acloque H, Wilkinson DG, Nieto MA. In situ hybridization analysis of chick embryos in whole-mount
and tissue sections. Methods in cell biology. 2008; 87:169–185. [PubMed: 18485297]
Altun G, Loring JF, Laurent LC. DNA methylation in embryonic stem cells. Journal of cellular
biochemistry. 2010; 109:1–6. [PubMed: 19899110]
Roellig and Bronner
Page 6
Dev Biol
. Author manuscript; available in PMC 2017 March 15.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
Bahar Halpern K, Vana T, Walker MD. Paradoxical role of DNA methylation in activation of FoxA2
gene expression during endoderm development. The Journal of biological chemistry. 2014;
289:23882–23892. [PubMed: 25016019]
Ball MP, Li JB, Gao Y, Lee JH, LeProust EM, Park IH, Xie B, Daley GQ, Church GM. Targeted and
genome-scale strategies reveal gene-body methylation signatures in human cells. Nature
biotechnology. 2009; 27:361–368.
Betancur P, Bronner-Fraser M, Sauka-Spengler T. Genomic code for Sox10 activation reveals a key
regulatory enhancer for cranial neural crest. Proceedings of the National Academy of Sciences of
the United States of America. 2010; 107:3570–3575. [PubMed: 20139305]
Bhattacharyya S, Bronner-Fraser M. Hierarchy of regulatory events in sensory placode development.
Current opinion in genetics & development. 2004; 14:520–526. [PubMed: 15380243]
Cheng X, Blumenthal RM. Mammalian DNA methyltransferases: a structural perspective. Structure.
2008; 16:341–350. [PubMed: 18334209]
Cole MF, Johnstone SE, Newman JJ, Kagey MH, Young RA. Tcf3 is an integral component of the
core regulatory circuitry of embryonic stem cells. Genes & development. 2008; 22:746–755.
[PubMed: 18347094]
Ehrlich M, Sanchez C, Shao C, Nishiyama R, Kehrl J, Kuick R, Kubota T, Hanash SM. ICF, an
immunodeficiency syndrome: DNA methyltransferase 3B involvement, chromosome anomalies,
and gene dysregulation. Autoimmunity. 2008; 41:253–271. [PubMed: 18432406]
Ekker M, Akimenko MA, Bremiller R, Westerfield M. Regional expression of three homeobox
transcripts in the inner ear of zebrafish embryos. Neuron. 1992; 9:27–35. [PubMed: 1352984]
Groves AK, Bronner-Fraser M. Competence, specification and commitment in otic placode induction.
Development. 2000; 127:3489–3499. [PubMed: 10903174]
Hidalgo-Sanchez M, Alvarado-Mallart R, Alvarez IS. Pax2, Otx2, Gbx2 and Fgf8 expression in early
otic vesicle development. Mechanisms of development. 2000; 95:225–229. [PubMed: 10906468]
Hu N, Strobl-Mazzulla P, Sauka-Spengler T, Bronner ME. DNA methyltransferase3A as a molecular
switch mediating the neural tube-to-neural crest fate transition. Genes & development. 2012;
26:2380–2385. [PubMed: 23124063]
Jeanpierre M, Turleau C, Aurias A, Prieur M, Ledeist F, Fischer A, Viegas- Pequignot E. An
embryonic-like methylation pattern of classical satellite DNA is observed in ICF syndrome.
Human molecular genetics. 1993; 2:731–735. [PubMed: 8102570]
Kim CH, Oda T, Itoh M, Jiang D, Artinger KB, Chandrasekharappa SC, Driever W, Chitnis AB.
Repressor activity of Headless/Tcf3 is essential for vertebrate head formation. Nature. 2000;
407:913–916. [PubMed: 11057671]
Kwon O, Jeong SJ, Kim SO, He L, Lee HG, Jang KL, Osada H, Jung M, Kim BY, Ahn JS.
Modulation of E-cadherin expression by K-Ras; involvement of DNA methyltransferase-3b.
Carcinogenesis. 2010; 31:1194–1201. [PubMed: 20375073]
Ladher RK, O'Neill P, Begbie J. From shared lineage to distinct functions: the development of the
inner ear and epibranchial placodes. Development. 2010; 137:1777–1785. [PubMed: 20460364]
Li B, Kuriyama S, Moreno M, Mayor R. The posteriorizing gene Gbx2 is a direct target of Wnt
signalling and the earliest factor in neural crest induction. Development. 2009; 136:3267–3278.
[PubMed: 19736322]
Linhart HG, Lin H, Yamada Y, Moran E, Steine EJ, Gokhale S, Lo G, Cantu E, Ehrich M, He T,
Meissner A, Jaenisch R. Dnmt3b promotes tumorigenesis in vivo by gene-specific de novo
methylation and transcriptional silencing. Genes & development. 2007; 21:3110–3122. [PubMed:
18056424]
Lister R, Pelizzola M, Dowen RH, Hawkins RD, Hon G, Tonti-Filippini J, Nery JR, Lee L, Ye Z, Ngo
QM, Edsall L, Antosiewicz-Bourget J, Stewart R, Ruotti V, Millar AH, Thomson JA, Ren B,
Ecker JR. Human DNA methylomes at base resolution show widespread epigenomic differences.
Nature. 2009; 462:315–322. [PubMed: 19829295]
Liu D, Chu H, Maves L, Yan YL, Morcos PA, Postlethwait JH, Westerfield M. Fgf3 and Fgf8
dependent and independent transcription factors are required for otic placode specification.
Development. 2003; 130:2213–2224. [PubMed: 12668634]
Roellig and Bronner
Page 7
Dev Biol
. Author manuscript; available in PMC 2017 March 15.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
Merrill BJ, Pasolli HA, Polak L, Rendl M, Garcia-Garcia MJ, Anderson KV, Fuchs E. Tcf3: a
transcriptional regulator of axis induction in the early embryo. Development. 2004; 131:263–274.
[PubMed: 14668413]
Meulemans D, Bronner-Fraser M. Gene-regulatory interactions in neural crest evolution and
development. Developmental cell. 2004; 7:291–299. [PubMed: 15363405]
Miranda TB, Jones PA. DNA methylation: the nuts and bolts of repression. Journal of cellular
physiology. 2007; 213:384–390. [PubMed: 17708532]
Momparler RL, Bovenzi V. DNA methylation and cancer. Journal of cellular physiology. 2000;
183:145–154. [PubMed: 10737890]
Okano M, Bell DW, Haber DA, Li E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for
de novo methylation and mammalian development. Cell. 1999; 99:247–257. [PubMed: 10555141]
Paxton CN, Bleyl SB, Chapman SC, Schoenwolf GC. Identification of differentially expressed genes
in early inner ear development. Gene Expr Patterns. 2010; 10:31–43. [PubMed: 19913109]
Provenzano MJ, Domann FE. A role for epigenetics in hearing: Establishment and maintenance of
auditory specific gene expression patterns. Hear Res. 2007; 233:1–13. [PubMed: 17723285]
Robertson KD, Uzvolgyi E, Liang G, Talmadge C, Sumegi J, Gonzales FA, Jones PA. The human
DNA methyltransferases (DNMTs) 1, 3a and 3b: coordinate mRNA expression in normal tissues
and overexpression in tumors. Nucleic acids research. 1999; 27:2291–2298. [PubMed: 10325416]
Sauka-Spengler T, Barembaum M. Gain- and loss-of-function approaches in the chick embryo.
Methods in cell biology. 2008; 87:237–256. [PubMed: 18485300]
Solomon KS, Fritz A. Concerted action of two dlx paralogs in sensory placode formation.
Development. 2002; 129:3127–3136. [PubMed: 12070088]
Stacey M, Bennett MS, Hulten M. FISH analysis on spontaneously arising micronuclei in the ICF
syndrome. J Med Genet. 1995; 32:502–508. [PubMed: 7562960]
Steventon B, Mayor R, Streit A. Mutual repression between Gbx2 and Otx2 in sensory placodes
reveals a general mechanism for ectodermal patterning. Developmental biology. 2012; 367:55–65.
[PubMed: 22564795]
Streit A. The preplacodal region: an ectodermal domain with multipotential progenitors that contribute
to sense organs and cranial sensory ganglia. The International journal of developmental biology.
2007; 51:447–461. [PubMed: 17891708]
Streit A, Stern CD. Establishment and maintenance of the border of the neural plate in the chick:
involvement of FGF and BMP activity. Mechanisms of development. 1999; 82:51–66. [PubMed:
10354471]
van Overveld PG, Lemmers RJ, Sandkuijl LA, Enthoven L, Winokur ST, Bakels F, Padberg GW, van
Ommen GJ, Frants RR, van der Maarel SM. Hypomethylation of D4Z4 in 4q-linked and non-4q-
linked facioscapulohumeral muscular dystrophy. Nat Genet. 2003; 35:315–317. [PubMed:
14634647]
Wilkinson, DG. situ hybridization: A practical approach. IRL Press; Oxford, UK: 1992. Whole mount
in situ hybridization of vertebrate embryos.; p. 75-83.
Xie S, Wang Z, Okano M, Nogami M, Li Y, He WW, Okumura K, Li E. Cloning, expression and
chromosome locations of the human DNMT3 gene family. Gene. 1999; 236:87–95. [PubMed:
10433969]
Yi F, Pereira L, Hoffman JA, Shy BR, Yuen CM, Liu DR, Merrill BJ. Opposing effects of Tcf3 and
Tcf1 control Wnt stimulation of embryonic stem cell self-renewal. Nat Cell Biol. 2011; 13:762–
770. [PubMed: 21685894]
Roellig and Bronner
Page 8
Dev Biol
. Author manuscript; available in PMC 2017 March 15.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
Highlights
epigenetic modifier DNMT3A influences development of the otic placode
DNMT3A knock down reduces expression of early otic placode specifiers Pax2
and Gbx2
DNMT3A knock down causes a reduction in the size of the otic vesicle
DNMT3A acts as a positive regulator of Gbx2 expression during inner ear
development
Roellig and Bronner
Page 9
Dev Biol
. Author manuscript; available in PMC 2017 March 15.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
Fig. 1.
DNMT3A is expressed at sites of otic placode formation. DNMT3A transcripts are
expressed (A) in the neural plate border region (HH 4), (B, C) the dorsal neural folds and
otic placode (HH 6, 8). Dashed circles indicate position of otic precursors/placode. Black
lines indicate position of section (A’, B’, C’). Right half of embryo is shown for sections.
Arrowheads mark the position of the otic placode/vesicle. HH, staging after Hamburger and
Hamilton.
Roellig and Bronner
Page 10
Dev Biol
. Author manuscript; available in PMC 2017 March 15.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
Fig. 2.
Morpholino-mediated knock down of DNMT3A reduces otic marker expression and otic
vesicle size. DNMT3A MO or control MO were electroporated into the right or left half of
the embryo, respectively, at HH4. Morpholinos were FITC-labeled (green, small insets). (A,
A’) Gbx2 RNA expression was reduced in the pre-placodal domain at HH7 on the 3A MO
electroporated side. Black line indicates level of section (A’). (B) At HH9 Gbx2 RNA
expression was reduced in the otic placode on the 3A MO electroporated side. Black line
indicates level of section (B’). (C) At HH13 otic vesicle size was reduced on the 3A MO
Roellig and Bronner
Page 11
Dev Biol
. Author manuscript; available in PMC 2017 March 15.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
injected side. (D) Graph shows quantification of Gbx2 loss of expression phenotype
comparing 3A MO injected sides (n=18) to control MO or uninjected sides (n=26) at
HH9-10. (E) DNMT3A morpholino knock down causes reduced Pax2 RNA expression in
the otic area. Black line indicates level of section (E’). (F) The graph shows a quantification
of the Pax2 loss of expression phenotype. Knock down, n=24; control, n=14. Arrowheads
mark the position of the otic placode/vesicle on the 3AMO electroporated side. (G, G’)
Expression of epidermal marker Ck19 is unaltered upon DNMT3A MO knockdown (n=9).
Bar, 50 μm.
Roellig and Bronner
Page 12
Dev Biol
. Author manuscript; available in PMC 2017 March 15.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
Fig. 3.
Loss of Gbx2 is rescued by exogenous DNMT3A. Embryos were electroporated with
DNMT3A MO in combination with (A) empty vector or (B) DNMT3A expression construct
or (C) embryos were electroporated with control MO and DNMT3A expression vector. (D)
Graph represents a quantification of embryos with a strong, mild or no effect on Gbx2
expression phenotype upon DNMT3A MO knock down compared to rescue and
overexpression experiments. Knockdown, n=9; rescue, n=13; overexpression, n=7.
Roellig and Bronner
Page 13
Dev Biol
. Author manuscript; available in PMC 2017 March 15.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
Fig. 4.
Knock down of DNMT3A does not affect expression of early neural plate border and non-
neural ectoderm markers Msx1, Erni, Dlx5 and Six1. HH4 embryos were electroporated
with FITC labeled control MO (left side) or DNMT3A MO (right side). RNA levels of
neural plate border markers (A) Msx1 (n=8/9), (B) Erni (8/8) and the non-neural ectoderm
markers (C) Dlx5 (n=8/8) and (D) Six1 (n=6/7) were not reduced on the DNMT3A MO
injected side. Black line indicates level of section (A’–D’). Bar, 50 μm.
Roellig and Bronner
Page 14
Dev Biol
. Author manuscript; available in PMC 2017 March 15.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript
Fig. 5.
Otx2, Sox2 and Sox3 expression remains unchanged upon DNMT3A knock down. Embryos
were injected with 3A MO on the embryonic right side. Morpholinos were FITC-labeled
(green, small insets). DNMT3A knock down leaves (A) Otx2 (n=13/13), (B) Sox2 (n=7/7)
and (C) Sox3 (n=7/8) expression unaltered. Dashed circles indicate position of otic domain.
(D) Model of function of DNMT3A during otic development. In presence of DNMT3A,
CpG islands in the putative repressor binding sites are methylated, preventing repressor
binding to the target gene. When DNMT3A is decreased, methylation of repressor binding
sites is reduced or not present. This allows repressors to bind and prevents target gene
expression.
Roellig and Bronner
Page 15
Dev Biol
. Author manuscript; available in PMC 2017 March 15.
Author Manuscript
Author Manuscript
Author Manuscript
Author Manuscript