nihms-757595.pdf

The epigenetic modifier DNMT3A is necessary for proper otic

placode formation

Daniela Roellig

and

Marianne E. Bronner

Division of Biology and Biological Engineering, California Institute of Technology, Pasadena, CA

91125 USA

Abstract

Cranial placodes are thickenings in the ectoderm that give rise to sensory organs and peripheral

ganglia of the vertebrate head. At gastrula and neurula stages, placodal precursors are intermingled

in the neural plate border with future neural and neural crest cells. Here, we show that the

epigenetic modifier, DNA methyl transferase (DNMT) 3A, expressed in the neural plate border

region, influences development of the otic placode which will contribute to the ear. DNMT3A is

expressed in the presumptive otic region at gastrula through neurula stages and later in the otic

placode itself. Whereas neural plate border and non-neural ectoderm markers Erni, Dlx5, Msx1

and Six1 are unaltered, DNMT3A loss of function leads to early reduction in the expression of the

key otic placode specifier genes Pax2 and Gbx2 and later otic markers Sox10 and Soho1.

Reduction of Gbx2 was first observed at HH7, well before loss of other otic markers. Later, this

translates to significant reduction in the size of the otic vesicle. Based on these results, we propose

that DNMT3A is important for enabling the activation of Gbx2 expression, necessary for normal

development of the inner ear.

Keywords

otic; placode; DNMT3A; Gbx2; Pax2

Introduction

Cranial ectodermal placodes are thickened epithelial structures in the head ectoderm of the

early embryo that contribute to sensory organs (ear, eye and olfactory epithelium) and major

ganglia of the head (trigeminal, epibranchial). All placode precursors arise at gastrula and

neurula stages from the neural plate border region, between prospective neural and non-

neural ectoderm, where they are intermingled with future neural and neural crest cells

mbronner@caltech.edu (corresponding author).

roellig@caltech.edu

Publisher's Disclaimer:

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our

customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of

the resulting proof before it is published in its final citable form. Please note that during the production process errors may be

discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Conflict of Interest statement. None declared.

HHS Public Access

Author manuscript

Dev Biol

. Author manuscript; available in PMC 2017 March 15.

Published in final edited form as:

Dev Biol

. 2016 March 15; 411(2): 294–300. doi:10.1016/j.ydbio.2016.01.034.

Author Manuscript

(

Bhattacharyya and Bronner-Fraser, 2004

;

Meulemans and Bronner-Fraser, 2004

;

Streit and

Stern, 1999

Temporal and spatial integration of different signals and transcription factors defines the

neural plate border territory. At neurula stages, mesenchymal FGF signaling induces Wnt8a

and FGF signaling in neural ectoderm that defines the pre-placodal region in the non-neural

ectoderm. Several transcription factors characteristic of this region are induced, including

Dlx family genes, Erni, Sox3, Msx1 and Foxi genes (

Ekker et al., 1992

;

Groves and

Bronner-Fraser, 2000

;

Liu et al., 2003

;

Solomon and Fritz, 2002

). At late neurula stages,

FGF, BMP and WNT signaling are thought to segregate fates within the border area by

regulating a set of transcription factors including Pax7, Snai2, FoxD3, Sox10, Six1/4 and

Eya1/2. Subsequently, on the basal side, FGF induces otic invagination (

Ladher et al., 2010

;

Streit, 2007

This complex network of signaling and transcription factors requires tight spatiotemporal

regulation, as might be provided by epigenetic modifiers. Recently, we showed that DNA

methylation by DNMT3A promotes neural crest fate while inhibiting neural fate (

Hu et al.,

2012

), suggesting a possible role for these epigenetic factors in regulating cell fate decisions

at the neural plate border. DNA methyltransferases function by recognizing CpG islands and

catalyzing the transfer of a methyl group to DNA on the C5 position of cytosine (

Cheng and

Blumenthal, 2008

). Methylation of CpG sites in the promoter region of a gene is thought to

inhibit its expression, as shown in cancer and stem cells (

Altun et al., 2010

;

Miranda and

Jones, 2007

;

Momparler and Bovenzi, 2000

). In some cases, DNMTs are also thought to

activate gene expression by directly methylating gene bodies (

Ball et al., 2009

;

Lister et al.,

2009

) or by inhibiting binding of repressors via methylation (

Bahar Halpern et al., 2014

Since DNMT3A is broadly expressed in the neural plate border territory from which not

only neural crest but also placodal precursors arise, this raised the possibility that it may be

required for normal placode development. Here, we test the function of DNMT3A on

formation of the otic placode and early development of the ear. The results show that loss of

DNMT3A causes loss of early ear markers Gbx2 and Pax2 as well as later otic markers

Sox10 and Soho1. This leads to later defects in the otic placode, suggesting that epigenetic

regulation is critical for normal ear development.

Results

DNMT3A is expressed in presumptive otic region and otic placode

As a first step in examining the possible relationship between DNMT3A and placode

development, we performed in situ hybridization at gastrula through neurula stages to

determine its expression pattern relative to that of ear precursors (dashed lines in Fig. 1). We

find that DNMT3A is expressed in the neural plate border at HH4 (Fig. 1A). While high

expression continues in the neural plate, as previously shown (

Hu et al., 2012

), DNMT3A

also is expressed laterally in the presumptive ear territory at HH6 (Fig. 1B) and HH8 (Fig.

1C). Transverse sections reveal that expression is elevated in the ectodermal layer at the

stages examined (Fig. 1A’, B’, C’).

Roellig and Bronner

Page 2

Dev Biol

. Author manuscript; available in PMC 2017 March 15.

Author Manuscript

Inhibition of DNMT3A reduces the expression of otic placode markers and the size of the

otic vesicle

To assess the functional importance of DNMT3A, we performed loss of function

experiments using a translational blocking morpholino (MO) (

Hu et al., 2012

). The

morpholino was electroporated into the gastrula stage embryo at HH4 either targeting one

half of the head region or the lateral placode-forming region of the embryo. The effects on

placode development were examined at subsequent developmental stages by in situ

hybridization to determine effects on otic marker genes.

Knock down of DNMT3A caused a down-regulation of the otic placode marker Gbx2 very

early in the process of placode specification, by HH7 (Fig. 2A, A’). At HH9 Gbx2 was

markedly down-regulated in the DNMT3A MO treated side (Fig. 2B, B’, D). Similar results

were obtained for Pax2, another otic placode marker, at HH10 (Fig. 2E, E’, F).

We also noted down-regulation of Sox10 at HH11 after initiation of its expression in the otic

placode (Fig. S1A, B), similar to its effects on Sox10 expression in the neural crest (

Hu et

al., 2012

), and otic expression of Soho1 at HH12 (Fig S1C) upon DNMT3A MO treatment.

Interestingly, DNMT3A MO knockdown did not alter the expression of the epidermal

marker Ck19 in the otic region (Fig 2G, G’).

The early effects on gene expression led to subsequent defects in otic development as

evidenced by a reduced size of the otic vesicle (Fig. 2C). By the time that the morpholino

was introduced at HH4, DNMT3A is already expressed. Thus, it is likely that some

DNMT3A activity persists in the treated embryos due to perdurance of already translated

protein and stability of resulting DNA methylation, likely explaining the semi-penetrant

effects on otic vesicle formation.

To control for the specificity of the DNMT3A morpholino and demonstrate that the

observed phenotype was not due to off-target effects, we coelectroporated the DNMT3A

MO with a construct encoding ubiquitously expressed DNMT3A. This resulted in a marked

rescue of the loss of function phenotype and restored Gbx2 expression (Fig. 3A, B, D).

Over-expression of the DNMT3A rescue construct alone did not alter Gbx2 expression (Fig.

3C).

Altogether these results suggest that DNMT3A is critical for epigenetic regulation of the otic

placode formation and normal early development of the inner ear.

DNMT3A knockdown does not alter expression of early neural plate border and non-neural

ectoderm markers

Because DNMT3A expression is already present at HH4, it is possible that loss of Gbx2 and

Pax2 in the otic domain might be secondary to abnormalities in the formation of the neural

plate border. To examine this possibility, we tested whether loss of DNMT3A influenced

expression of genes important for neural plate border specification. The results show that

expression of key early neural plate border markers Erni and Msx1 (Fig. 4 A, B) and non-

neural ectoderm markers Dlx5 and Six1 (Fig. 4 C, D) was unaltered when comparing the

DNMT3A-MO injected side with the contralateral control MO injected side of the same

Roellig and Bronner

Page 3

Dev Biol

. Author manuscript; available in PMC 2017 March 15.

Author Manuscript

embryo. This suggests that loss of the otic fate is not due to a secondary effect on neural

plate border formation.

Mutual repression between Gbx2 and Otx2 has been reported in sensory placode formation

(

Steventon et al., 2012

). Therefore we also tested whether DNMT3A knock down causes an

expansion of Otx2 expression at the expense of Gbx2. However, the results revealed no

change in Otx2 expression (Fig. 5A). Similarly, expression of Sox2 and Sox3, previously

shown to be direct targets of DNMT3A during neural crest formation (

Hu et al., 2012

), were

unaffected in the otic placodal domain at HH9 (Fig. 5B, C).

FGF signaling from tissues basal to the otic area has been shown to be important for proper

otic invagination (

Ladher et al., 2010

;

Streit, 2007

). Therefore we checked the expression of

a downstream effector of FGF signaling, Erm, to investigate whether the pre-placodal

ectoderm is receiving FGF signals in the morphant embryos. Additionally, since canonical

WNT signaling is important for Gbx2 expression (

Li et al., 2009

), we checked expression of

a downstream repressor, Tcf3 (

Cole et al., 2008

;

Kim et al., 2000

;

Merrill et al., 2004

;

Yi et

al., 2011

). We picked these markers, because they are both expressed in the region of

interest at the time when we observe reduced Gbx2 expression upon DNMT3A knock down.

However, both markers, Tcf3 and Erm, were unaltered upon DNMT3A knock down (Fig.

S2).

Taken together, these results show that loss of DNMT3A selectively effects formation of the

otic placode domain without influencing neural plate border formation.

Discussion

DNMT3s are essential for de novo methylation during early developmental stages (

Okano et

al., 1999

). They play important roles in cancer and disease, but also normal aspects of

mammalian development (

Ehrlich et al., 2008

;

Linhart et al., 2007

). Many tumor suppressor

genes are silenced in a variety of human cancer cells by promoter methylation whereas some

oncogenes are activated by hypomethylation. In tumor cells, excessive levels of DNMT3B

bind to the promoter region of E-cadherin, reducing adhesion and aggregation, which

correlates with increased metastasis (

Kwon et al., 2010

). Several studies demonstrate a role

of DNMT3 methyltransferases in development. Single DNMT3B null embryos have rostral

neural tube defects and growth impairment, whereas DNMT3A and 3B double mutants are

embryonic lethal (

Okano et al., 1999

Interestingly, alterations in DNA methylation have also been associated with several

syndromes that cause hearing related problems (

Provenzano and Domann, 2007

). For

instance DNA hypomethylation has been related with hearing loss in patients with ICF

syndrome (immunodeficiency, centromere instability, facial anomalies) (

Robertson et al.,

1999

;

Xie et al., 1999

). In this disease, large parts of several chromosomes remain

unmethylated, which leads to chromosomal rearrangements, thereby effecting gene

expression (

Jeanpierre et al., 1993

;

Stacey et al., 1995

). Hearing loss has also been reported

in patients with facioscapulohumeral muscular dystrophy (FSHD1). Deletions and

Roellig and Bronner

Page 4

Dev Biol

. Author manuscript; available in PMC 2017 March 15.

Author Manuscript

hypomethylation in the D4Z4 array on chromosome 4 seem key events in this disease (

van

Overveld et al., 2003

These data suggest that DNMT3 methyltransferases have specificity to certain genes to

influence particular developmental processes during ear development. Here we show for the

first time an influence of DNMT3A on very early stages of inner ear development, during

the development of the otic placode.

Previous work from our lab has shown that DNMT3A is highly expressed in the neural plate

border at gastrula stages and, later on, is expressed in neural folds and neural crest cells (

et al., 2012

). Loss of functions experiments further revealed that epigenetic modifications

were crucial for neural versus neural crest cell fate decisions in the neural tube (

Hu et al.,

2012

), such that DNA methyltransferase DNMT3A promotes neural crest specification by

directly binding to and repressing the neural genes Sox2 and Sox3. In contrast, in the

developing ear, we find that Sox2 and Sox3 are neither expressed earlier nor is their

expression altered after DNMT3A loss in the otic area. This difference might be explained

by the possibility that DNMT3A cooperates with different cofactors in different tissues,

which would go in line with the late onset of Sox2, and Sox3 expression in the otic region

compared to the early neural tube expression of these two genes.

The present results show that, in addition to the neural plate border region, DNMT3A also is

expressed in the pre-placodal domain at gastrula stages and later at lower levels in the chick

otic placode domain. Selective loss of DNMT3A in the otic domain leads to loss of several

otic markers, Gbx2, Pax2, Sox10 and Soho1, and subsequent reduction of the otic vesicle.

This is in agreement with previous findings in mouse (

Okano et al., 1999

). Although the

authors did not focus on otic placode development in DNMT3A knockout mice, their data

suggest a reduction in otic vesicle size in DNMT3A

+/−

, but not DNMT3B

+/−

mice (

Okano et

al. 1999

, Fig. 3, compare D and H).

In general, DNMTs are thought to act via methylation of CpG islands in the promoter region

of genes, resulting in inhibition of gene expression. In contrast, the present data suggest that

DNMT3A acts as a positive regulator of Gbx2 and Pax2, either directly or indirectly. A

similar mechanism has been described for FoxA2 activation during endoderm development

(

Bahar Halpern et al., 2014

). This study hypothesized that in undifferentiated hESC-derived

early endoderm-stage cells, low DNA methylation of certain CpG islands enabled binding of

repressive proteins. Upon differentiation, DNA methylation of these CpG islands caused

loss of repressor binding, thus leading to activation of FoxA2.

We propose that a similar mechanism may be invoked in the otic placode, such that

DNMT3A methylation of CpG islands prevents binding of yet unknown repressors,

allowing the activation of otic marker expression. Accordingly to this model, in the presence

of DNMT3A, CpG islands in the putative repressor binding sites become methylated, thus

preventing repressor binding to the target gene. Loss of DNMT3A results in demethylation

of these repressor binding sites. In this state, the repressors bind and block target gene

expression (Fig. 5D).

Roellig and Bronner

Page 5

Dev Biol

. Author manuscript; available in PMC 2017 March 15.

Author Manuscript

In summary, we have interrogated the function of DNMT3A in early ear development. Our

results place DNMT3A upstream of one of the earliest otic genes Gbx2 (

Hidalgo-Sanchez et

al., 2000

;

Paxton et al., 2010

). Establishing epigenetic regulation as a driver of otic specifier

expression provides important insights into how the chick inner ear is induced.

Methods

Embryos

Fertilized chicken eggs were incubated at 37°C to the desired stages.

In situ hybridization

Embryos were fixed with 4% paraformaldehyde, washed with PBS/0.1% Tween, dehydrated

in MeOH, and stored at −20°C. Whole-mount in situ hybridization was performed as

described (

Acloque et al., 2008

;

Wilkinson, 1992

). Dioxigenin-labeled RNA probes were

made from DNA plasmids or ESTs of DNMT3A, Dlx5, Erm, Erni, Gbx2, Msx1, Otx2,

Pax2, Six1, Sox2, Sox3, Sox10, Soho1, and. Tcf3. Embryos were cryo-sectioned at 20 mm.

Electroporation

Embryos were electroporated at HH 4–5 as described (

Sauka-Spengler and Barembaum,

2008

) using DNMT3AMO1 (over ATG codon) (TGGGTGTGTCACTGCTTTCCACCAT)

or DNMT3AMO2 (95 nucleotides upstream of ATG)

(CAGTGTCCCCACGGCGCTTCCTGCT) (

Hu et al., 2012

). The coding region of

DNMT3A (NM001024832.1) (

Hu et al., 2012

) was cloned into the pCI H2B-RFP vector

(

Betancur et al., 2010

) as rescue construct. For each embryo, 0.6-0.7 mM MO + 0.5 mg/mL

DNA was used for knockdown experiments, and 0.6 mM MO + 1-1.5 mg/mL DNA was

used for rescue experiments, except if stated otherwise in the text. The MO was targeted to

either half of the anterior side of the embryo or the presumptive otic region with five 50-

msec pulses of 5.2 V at 100-msec intervals. No phenotypic difference in the otic area was

observed between one and the other injection method. Electroporated embryos were

maintained in culture dishes with 1 mL of albumen at 37°C and then fixed.

Supplementary Material

Refer to Web version on PubMed Central for supplementary material.

Acknowledgements

We thank Bertrand Bénazéraf for helpful discussions and critical reading of the manuscript. This work was funded

by grants DC011577 and DE16459 from the NIH. DR was funded by the Deutsche Forschungsgemeinschaft (DFG;

RO 4334/1-1).

References

Acloque H, Wilkinson DG, Nieto MA. In situ hybridization analysis of chick embryos in whole-mount

and tissue sections. Methods in cell biology. 2008; 87:169–185. [PubMed: 18485297]

Altun G, Loring JF, Laurent LC. DNA methylation in embryonic stem cells. Journal of cellular

biochemistry. 2010; 109:1–6. [PubMed: 19899110]

Roellig and Bronner

Page 6

Dev Biol

. Author manuscript; available in PMC 2017 March 15.

Author Manuscript

Bahar Halpern K, Vana T, Walker MD. Paradoxical role of DNA methylation in activation of FoxA2

gene expression during endoderm development. The Journal of biological chemistry. 2014;

289:23882–23892. [PubMed: 25016019]

Ball MP, Li JB, Gao Y, Lee JH, LeProust EM, Park IH, Xie B, Daley GQ, Church GM. Targeted and

genome-scale strategies reveal gene-body methylation signatures in human cells. Nature

biotechnology. 2009; 27:361–368.

Betancur P, Bronner-Fraser M, Sauka-Spengler T. Genomic code for Sox10 activation reveals a key

regulatory enhancer for cranial neural crest. Proceedings of the National Academy of Sciences of

the United States of America. 2010; 107:3570–3575. [PubMed: 20139305]

Bhattacharyya S, Bronner-Fraser M. Hierarchy of regulatory events in sensory placode development.

Current opinion in genetics & development. 2004; 14:520–526. [PubMed: 15380243]

Cheng X, Blumenthal RM. Mammalian DNA methyltransferases: a structural perspective. Structure.

2008; 16:341–350. [PubMed: 18334209]

Cole MF, Johnstone SE, Newman JJ, Kagey MH, Young RA. Tcf3 is an integral component of the

core regulatory circuitry of embryonic stem cells. Genes & development. 2008; 22:746–755.

[PubMed: 18347094]

Ehrlich M, Sanchez C, Shao C, Nishiyama R, Kehrl J, Kuick R, Kubota T, Hanash SM. ICF, an

immunodeficiency syndrome: DNA methyltransferase 3B involvement, chromosome anomalies,

and gene dysregulation. Autoimmunity. 2008; 41:253–271. [PubMed: 18432406]

Ekker M, Akimenko MA, Bremiller R, Westerfield M. Regional expression of three homeobox

transcripts in the inner ear of zebrafish embryos. Neuron. 1992; 9:27–35. [PubMed: 1352984]

Groves AK, Bronner-Fraser M. Competence, specification and commitment in otic placode induction.

Development. 2000; 127:3489–3499. [PubMed: 10903174]

Hidalgo-Sanchez M, Alvarado-Mallart R, Alvarez IS. Pax2, Otx2, Gbx2 and Fgf8 expression in early

otic vesicle development. Mechanisms of development. 2000; 95:225–229. [PubMed: 10906468]

Hu N, Strobl-Mazzulla P, Sauka-Spengler T, Bronner ME. DNA methyltransferase3A as a molecular

switch mediating the neural tube-to-neural crest fate transition. Genes & development. 2012;

26:2380–2385. [PubMed: 23124063]

Jeanpierre M, Turleau C, Aurias A, Prieur M, Ledeist F, Fischer A, Viegas- Pequignot E. An

embryonic-like methylation pattern of classical satellite DNA is observed in ICF syndrome.

Human molecular genetics. 1993; 2:731–735. [PubMed: 8102570]

Kim CH, Oda T, Itoh M, Jiang D, Artinger KB, Chandrasekharappa SC, Driever W, Chitnis AB.

Repressor activity of Headless/Tcf3 is essential for vertebrate head formation. Nature. 2000;

407:913–916. [PubMed: 11057671]

Kwon O, Jeong SJ, Kim SO, He L, Lee HG, Jang KL, Osada H, Jung M, Kim BY, Ahn JS.

Modulation of E-cadherin expression by K-Ras; involvement of DNA methyltransferase-3b.

Carcinogenesis. 2010; 31:1194–1201. [PubMed: 20375073]

Ladher RK, O'Neill P, Begbie J. From shared lineage to distinct functions: the development of the

inner ear and epibranchial placodes. Development. 2010; 137:1777–1785. [PubMed: 20460364]

Li B, Kuriyama S, Moreno M, Mayor R. The posteriorizing gene Gbx2 is a direct target of Wnt

signalling and the earliest factor in neural crest induction. Development. 2009; 136:3267–3278.

[PubMed: 19736322]

Linhart HG, Lin H, Yamada Y, Moran E, Steine EJ, Gokhale S, Lo G, Cantu E, Ehrich M, He T,

Meissner A, Jaenisch R. Dnmt3b promotes tumorigenesis in vivo by gene-specific de novo

methylation and transcriptional silencing. Genes & development. 2007; 21:3110–3122. [PubMed:

18056424]

Lister R, Pelizzola M, Dowen RH, Hawkins RD, Hon G, Tonti-Filippini J, Nery JR, Lee L, Ye Z, Ngo

QM, Edsall L, Antosiewicz-Bourget J, Stewart R, Ruotti V, Millar AH, Thomson JA, Ren B,

Ecker JR. Human DNA methylomes at base resolution show widespread epigenomic differences.

Nature. 2009; 462:315–322. [PubMed: 19829295]

Liu D, Chu H, Maves L, Yan YL, Morcos PA, Postlethwait JH, Westerfield M. Fgf3 and Fgf8

dependent and independent transcription factors are required for otic placode specification.

Development. 2003; 130:2213–2224. [PubMed: 12668634]

Roellig and Bronner

Page 7

Dev Biol

. Author manuscript; available in PMC 2017 March 15.

Author Manuscript

Merrill BJ, Pasolli HA, Polak L, Rendl M, Garcia-Garcia MJ, Anderson KV, Fuchs E. Tcf3: a

transcriptional regulator of axis induction in the early embryo. Development. 2004; 131:263–274.

[PubMed: 14668413]

Meulemans D, Bronner-Fraser M. Gene-regulatory interactions in neural crest evolution and

development. Developmental cell. 2004; 7:291–299. [PubMed: 15363405]

Miranda TB, Jones PA. DNA methylation: the nuts and bolts of repression. Journal of cellular

physiology. 2007; 213:384–390. [PubMed: 17708532]

Momparler RL, Bovenzi V. DNA methylation and cancer. Journal of cellular physiology. 2000;

183:145–154. [PubMed: 10737890]

Okano M, Bell DW, Haber DA, Li E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for

de novo methylation and mammalian development. Cell. 1999; 99:247–257. [PubMed: 10555141]

Paxton CN, Bleyl SB, Chapman SC, Schoenwolf GC. Identification of differentially expressed genes

in early inner ear development. Gene Expr Patterns. 2010; 10:31–43. [PubMed: 19913109]

Provenzano MJ, Domann FE. A role for epigenetics in hearing: Establishment and maintenance of

auditory specific gene expression patterns. Hear Res. 2007; 233:1–13. [PubMed: 17723285]

Robertson KD, Uzvolgyi E, Liang G, Talmadge C, Sumegi J, Gonzales FA, Jones PA. The human

DNA methyltransferases (DNMTs) 1, 3a and 3b: coordinate mRNA expression in normal tissues

and overexpression in tumors. Nucleic acids research. 1999; 27:2291–2298. [PubMed: 10325416]

Sauka-Spengler T, Barembaum M. Gain- and loss-of-function approaches in the chick embryo.

Methods in cell biology. 2008; 87:237–256. [PubMed: 18485300]

Solomon KS, Fritz A. Concerted action of two dlx paralogs in sensory placode formation.

Development. 2002; 129:3127–3136. [PubMed: 12070088]

Stacey M, Bennett MS, Hulten M. FISH analysis on spontaneously arising micronuclei in the ICF

syndrome. J Med Genet. 1995; 32:502–508. [PubMed: 7562960]

Steventon B, Mayor R, Streit A. Mutual repression between Gbx2 and Otx2 in sensory placodes

reveals a general mechanism for ectodermal patterning. Developmental biology. 2012; 367:55–65.

[PubMed: 22564795]

Streit A. The preplacodal region: an ectodermal domain with multipotential progenitors that contribute

to sense organs and cranial sensory ganglia. The International journal of developmental biology.

2007; 51:447–461. [PubMed: 17891708]

Streit A, Stern CD. Establishment and maintenance of the border of the neural plate in the chick:

involvement of FGF and BMP activity. Mechanisms of development. 1999; 82:51–66. [PubMed:

10354471]

van Overveld PG, Lemmers RJ, Sandkuijl LA, Enthoven L, Winokur ST, Bakels F, Padberg GW, van

Ommen GJ, Frants RR, van der Maarel SM. Hypomethylation of D4Z4 in 4q-linked and non-4q-

linked facioscapulohumeral muscular dystrophy. Nat Genet. 2003; 35:315–317. [PubMed:

14634647]

Wilkinson, DG. situ hybridization: A practical approach. IRL Press; Oxford, UK: 1992. Whole mount

in situ hybridization of vertebrate embryos.; p. 75-83.

Xie S, Wang Z, Okano M, Nogami M, Li Y, He WW, Okumura K, Li E. Cloning, expression and

chromosome locations of the human DNMT3 gene family. Gene. 1999; 236:87–95. [PubMed:

10433969]

Yi F, Pereira L, Hoffman JA, Shy BR, Yuen CM, Liu DR, Merrill BJ. Opposing effects of Tcf3 and

Tcf1 control Wnt stimulation of embryonic stem cell self-renewal. Nat Cell Biol. 2011; 13:762–

770. [PubMed: 21685894]

Roellig and Bronner

Page 8

Dev Biol

. Author manuscript; available in PMC 2017 March 15.

Author Manuscript

Highlights

•

epigenetic modifier DNMT3A influences development of the otic placode

•

DNMT3A knock down reduces expression of early otic placode specifiers Pax2

and Gbx2

•

DNMT3A knock down causes a reduction in the size of the otic vesicle

•

DNMT3A acts as a positive regulator of Gbx2 expression during inner ear

development

Roellig and Bronner

Page 9

Dev Biol

. Author manuscript; available in PMC 2017 March 15.

Author Manuscript

Fig. 1.

DNMT3A is expressed at sites of otic placode formation. DNMT3A transcripts are

expressed (A) in the neural plate border region (HH 4), (B, C) the dorsal neural folds and

otic placode (HH 6, 8). Dashed circles indicate position of otic precursors/placode. Black

lines indicate position of section (A’, B’, C’). Right half of embryo is shown for sections.

Arrowheads mark the position of the otic placode/vesicle. HH, staging after Hamburger and

Hamilton.

Roellig and Bronner

Page 10

Dev Biol

. Author manuscript; available in PMC 2017 March 15.

Author Manuscript

Fig. 2.

Morpholino-mediated knock down of DNMT3A reduces otic marker expression and otic

vesicle size. DNMT3A MO or control MO were electroporated into the right or left half of

the embryo, respectively, at HH4. Morpholinos were FITC-labeled (green, small insets). (A,

A’) Gbx2 RNA expression was reduced in the pre-placodal domain at HH7 on the 3A MO

electroporated side. Black line indicates level of section (A’). (B) At HH9 Gbx2 RNA

expression was reduced in the otic placode on the 3A MO electroporated side. Black line

indicates level of section (B’). (C) At HH13 otic vesicle size was reduced on the 3A MO

Roellig and Bronner

Page 11

Dev Biol

. Author manuscript; available in PMC 2017 March 15.

Author Manuscript

injected side. (D) Graph shows quantification of Gbx2 loss of expression phenotype

comparing 3A MO injected sides (n=18) to control MO or uninjected sides (n=26) at

HH9-10. (E) DNMT3A morpholino knock down causes reduced Pax2 RNA expression in

the otic area. Black line indicates level of section (E’). (F) The graph shows a quantification

of the Pax2 loss of expression phenotype. Knock down, n=24; control, n=14. Arrowheads

mark the position of the otic placode/vesicle on the 3AMO electroporated side. (G, G’)

Expression of epidermal marker Ck19 is unaltered upon DNMT3A MO knockdown (n=9).

Bar, 50 μm.

Roellig and Bronner

Page 12

Dev Biol

. Author manuscript; available in PMC 2017 March 15.

Author Manuscript

Fig. 3.

Loss of Gbx2 is rescued by exogenous DNMT3A. Embryos were electroporated with

DNMT3A MO in combination with (A) empty vector or (B) DNMT3A expression construct

or (C) embryos were electroporated with control MO and DNMT3A expression vector. (D)

Graph represents a quantification of embryos with a strong, mild or no effect on Gbx2

expression phenotype upon DNMT3A MO knock down compared to rescue and

overexpression experiments. Knockdown, n=9; rescue, n=13; overexpression, n=7.

Roellig and Bronner

Page 13

Dev Biol

. Author manuscript; available in PMC 2017 March 15.

Author Manuscript

Fig. 4.

Knock down of DNMT3A does not affect expression of early neural plate border and non-

neural ectoderm markers Msx1, Erni, Dlx5 and Six1. HH4 embryos were electroporated

with FITC labeled control MO (left side) or DNMT3A MO (right side). RNA levels of

neural plate border markers (A) Msx1 (n=8/9), (B) Erni (8/8) and the non-neural ectoderm

markers (C) Dlx5 (n=8/8) and (D) Six1 (n=6/7) were not reduced on the DNMT3A MO

injected side. Black line indicates level of section (A’–D’). Bar, 50 μm.

Roellig and Bronner

Page 14

Dev Biol

. Author manuscript; available in PMC 2017 March 15.

Author Manuscript

Fig. 5.

Otx2, Sox2 and Sox3 expression remains unchanged upon DNMT3A knock down. Embryos

were injected with 3A MO on the embryonic right side. Morpholinos were FITC-labeled

(green, small insets). DNMT3A knock down leaves (A) Otx2 (n=13/13), (B) Sox2 (n=7/7)

and (C) Sox3 (n=7/8) expression unaltered. Dashed circles indicate position of otic domain.

(D) Model of function of DNMT3A during otic development. In presence of DNMT3A,

CpG islands in the putative repressor binding sites are methylated, preventing repressor

binding to the target gene. When DNMT3A is decreased, methylation of repressor binding

sites is reduced or not present. This allows repressors to bind and prevents target gene

expression.

Roellig and Bronner

Page 15

Dev Biol

. Author manuscript; available in PMC 2017 March 15.

Author Manuscript