Bacterial Argonaute proteins aid cell division in the presence of topoisomerase inhibitors in Escherichia coli

Bacterial Argonaute proteins aid cell division in the presence of topoisomerase

inhibitors in

Escherichia coli

Anna Olina

, Aleksei Agapov

, Denis Yudin

1,3

, Anton Kuzmenko

1,2

, Alexei A. Aravin

, Andrey

Kulbachinskiy

Institute of Molecular Genetics, National Research Center “Kurchatov Institute”, Moscow

123182, Russia

Division of Biology and Biological Engineering, California Institute of Technology, Pasadena, CA

91125, USA

Present address: Department of Biology, Institute of Molecular Biology and Biophysics, ETH

Zurich, Otto-Stern-Weg 5, CH-8093 Zurich, Switzerland

* To whom correspondence should be addressed: avkulb@yandex.ru

ABSTRACT

Prokaryotic Argonaute (pAgo) proteins are guide-dependent nucleases that function in host

defense against invaders. Recently, it was shown that TtAgo from

Thermus thermophilus

also

participates in the completion of DNA replication by decatenating chromosomal DNA. Here, we

show that two pAgos from cyanobacteria

Synechococcus elongatus

(SeAgo)

and

Limnothrix

roseae

(LrAgo) act as DNA-guided DNA nucleases in

Escherichia coli

and aid cell division in the

presence of the gyrase inhibitor ciprofloxacin. Both pAgos are preferentially loaded with small

DNA guides derived from the sites of replication termination. The amount of pAgo-associated

small DNAs (smDNAs) from the termination sites is increased in the presence ciprofloxacin,

suggesting that smDNA biogenesis depends on DNA replication and is stimulated by gyrase

inhibition. Ciprofloxacin also enhances asymmetry in the distribution of smDNAs around Chi-

sites, indicating that it induces double-strand breaks that serve as a source of smDNA during

their processing by RecBCD. While active in

E. coli

, SeAgo does not protect its native host

elongatus

from ciprofloxacin. These results suggest that pAgo nucleases help to complete

replication of chromosomal DNA by targeting the sites of termination, and may switch their

functional activities when expressed in different host species.

Keywords:

prokaryotic Argonaute proteins, topoisomerase, DNA replication,

ter

sites, cell

division

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

INTRODUCTION

Argonaute (Ago) proteins are an evolutionary conserved family of programmable nucleases that

are found in all three domains of life (1-3). Eukaryotic Argonautes (eAgos) participate in RNA

interference and use small RNA guides to recognize RNA targets

(4-7)

. This is followed by target

RNA cleavage through an intrinsic endonucleolytic activity of eAgo or by recruitment of

accessory factors, resulting in post-transcriptional or transcriptional gene silencing (8-11).

When first identified in bacteria and archaea, prokaryotic Argonautes (pAgos) served as models

to study the structure and biochemical properties of Ago proteins (3, 12-18), but their

functional activities in host species remained unknown. Phylogenetic analysis demonstrated

that pAgos are much more diverse than eAgos, and only a smaller part of them are catalytically

active (1, 2, 19, 20). This analysis also revealed widespread horizontal transfer of pAgos among

bacterial and archaeal species, suggesting that they can function in various genetic contexts and

environments.

In vitro

studies of several pAgo proteins demonstrated that their primary target is DNA rather

than RNA. Recognition of DNA targets by pAgos can be guided by small DNAs, as observed for

most studied pAgos, or by small RNAs (21-30). These findings were corroborated by

in vivo

analysis of several DNA-targeting pAgo proteins in bacterial cells, which revealed that pAgos

preferentially recognize foreign DNA such as plasmids, mobile elements and phages. In

particular, it was shown that RsAgo from

Rhodobacter sphaeroides

, TtAgo from

Thermus

thermophilus

PfAgo from

Pyrococcus furiosus

, and CbAgo from

Clostridium butyricum

decrease

plasmid DNA content and transformation efficiency, and CbAgo counteracts phage infection

(22, 26, 28, 29, 31). Accordingly, these pAgos are preferentially loaded with guide molecules

corresponding to plasmid or phage sequences during their expression in

E. coli

(26, 29, 31). As

demonstrated for CbAgo, generation of small guide DNAs from foreign genetic elements

depends on both the catalytic activity of pAgo itself and the action of cellular nucleases (31).

These studies suggested that catalytically active pAgos perform targeted degradation of foreign

DNA, even if they are expressed in heterologous cells.

Recent studies suggested that elimination of invader DNA may not be the sole function of

pAgos. In particular, TtAgo was shown to increase the resistance of its host bacterium

thermophilus

to ciprofloxacin, an inhibitor of DNA gyrase that impairs DNA replication and

prevents normal cell division (32). TtAgo was shown to target the region of replication

termination and participate in decatenation of chromosomal DNA, thus helping to complete

DNA replication when the gyrase function is inhibited (32). However, it remained unknown

whether this function in cell division is conserved among other DNA-targeting pAgos.

Here, we have analyzed two pAgo proteins from mesophilic cyanobacteria, SeAgo from

Synechococcus elongatus

and LrAgo from

Limnothrix roseae

. SeAgo is more closely related to

TtAgo (35.7% identity in the MID and PIWI domains), while LrAgo is more distant from it on the

phylogenetic tree (25.8% identity) (19). Both SeAgo and LrAgo are DNA-guided DNA nucleases

that can perform precise cleavage of target DNA

in vitro

(24, 25). SeAgo was previously shown

to interact with small guide DNAs in its native host

S. elongatus

but without obvious target

specificity (25). Here, we have found that, when expressed in a heterologous

E. coli

host, both

SeAgo and LrAgo are loaded with small DNAs corresponding to the sites of replication

termination. Furthermore, both SeAgo and LrAgo increase

E. coli

resistance to the gyrase

inhibitor ciprofloxacin, suggesting that targeting of termination

sites by pAgos may aid DNA

replication in various prokaryotic species.

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

RESULTS

Cyanobacterial pAgos rescue

E. coli

growth in the presence of topoisomerase inhibitors

To explore whether SeAgo and LrAgo can affect DNA replication and cell division, we expressed

them in the heterologous

E. coli

system. The SeAgo and LrAgo genes were cloned under the

control of an arabinose-inducible promoter in pBAD-based vectors (Fig. 1A). Western blots

confirmed that both proteins were expressed after the addition of arabinose (Fig. S1A). We

then studied their effects on cell growth and resistance to gyrase inhibition, and further

analyzed their DNA specificity

in vivo

(Fig. 1).

We first determined the range of sublethal concentrations of ciprofloxacin in the absence of

pAgo proteins, by measuring the kinetics of cell growth (OD

600

curves) of an

E. coli

strain

containing an empty expression plasmid. The cell growth was partially inhibited at 0.3-0.5

g/ml of ciprofloxacin and was almost completely inhibited at 3

g/ml of ciprofloxacin (Fig.

S1B). We then tested the effects of the pAgo proteins on cell growth. LrAgo and SeAgo did not

affect the growth kinetics in the absence of ciprofloxacin, however, both proteins protected the

cells from the sublethal concentration of ciprofloxacin (0.5

g/ml). LrAgo partially rescued cell

growth, while SeAgo was able to restore cell growth completely (Fig. 2A and S3A). These

experiments suggested that both pAgos can help the cells overcome the inhibitory effects of

ciprofloxacin on DNA replication.

Previous experiments with TtAgo suggested that it helps to decatenate chromosomes by

introducing double-strand breaks in the genomic DNA of

T. thermophilus

(32)

If SeAgo and

LrAgo acted by a similar mechanism,

double-strand breaks generated during this process should

subsequently be repaired by homologous recombination, depending on the RecA protein and

the RecBCD helicase-nuclease involved in double-strand break processing

(33-35). To test

whether this was the case, we measured the effects of ciprofloxacin and pAgos in

E. coli

strains

with deletions of

recA

and

recB/recD

. As expected, ciprofloxacin had stronger effects on the

growth of these strains in comparison with wild-type cells (Fig. 2B). Notably, SeAgo and LrAgo

did not stimulate the growth of

recA-

minus and

recBrecD

-minus strains in the presence of

ciprofloxacin (Fig. 2B), suggesting that the function of the pAgo proteins depends on the

homologous recombination machinery.

pAgos suppress the effects of ciprofloxacin on cell division and morphology

The observed effects of ciprofloxacin on the density of cell cultures may not directly correspond

to changes in the number of viable bacteria, because problems in cell division caused by the

antibiotic induce formation of multinucleated cells (36) (see Discussion). We therefore directly

compared the number of colony forming units (CFU) and analyzed cell morphology in bacterial

cultures grown in the absence and in the presence of ciprofloxacin. After 4.5 hours of growth,

when the effects of ciprofloxacin just became visible on the growth curves obtained by optical

density measurements (Fig. 2), ciprofloxacin dramatically decreased CFU numbers in the wild-

type

E. coli

strain (20- to 360-fold in three replicate experiments) (Fig. S2). Microscopy analysis

revealed that the inhibition of cell division by ciprofloxacin caused disappearance of individual

cells and formation of long multinucleated filaments (Fig. 3A, top panels).

We then analyzed the effects of pAgo expression on the number of viable bacteria. In the

absence of ciprofloxacin, CFU numbers were similar in control and pAgo-expressing strains (Fig.

S2). In contrast, in the presence of ciprofloxacin CFU numbers were strongly increased in the

strains expressing pAgos. This effect was especially prominent in the case of SeAgo; for this

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

strain, ciprofloxacin decreased cell numbers only 3-16-fold in comparison with up to 360-fold

inhibition observed in the control strain (Fig. S2). Microscopy analysis showed that expression

of both SeAgo and LrAgo resulted in disappearance of long filaments induced by ciprofloxacin

and increased the number of individual cells (or short filaments in the case of LrAgo) (Fig. 3A,

middle and bottom panels).

Since ciprofloxacin primarily targets gyrase, we analyzed the effects of gyrase knockdown on

cell morphology in control cells and upon pAgos expression. To silence gyrase expression,

catalytically-inactive dCas9 and sgRNA corresponding to the beginning of the coding region of

the

gyrA

gene were expressed in the

E. coli

strains

lacking or containing pAgos. Control

experiments demonstrated that only low level of gyrase knockdown could be achieved by this

approach (10-20% decrease in the mRNA levels measured by quantitative PCR). However, this

was sufficient to observe formation of short cell filaments by microscopy (Fig. 3B, top panels).

Similarly to the experiments with ciprofloxacin, these filaments disappeared in the presence of

pAgos (Fig. 3B, middle and bottom panels). Together, these results suggest that pAgos can aid

cell division in

E. coli

cells

when gyrase is inhibited by either ciprofloxacin or transcriptional

knockdown, indicating that they may help to complete DNA replication impaired by

topoisomerase deficiency.

pAgo-bound smDNAs are generated in RecBCD-dependent manner and are enriched in the

termination region of the chromosome

Previous analysis of small guide DNAs (smDNAs) associated with TtAgo in its native host

demonstrated that they are highly enriched around the region of replication termination. This

led to the suggestion that TtAgo may facilitate decatenation of chromosomal DNA by targeting

the

ter-

region of the chromosome and possibly introducing double-strand breaks in this region

(32). To explore whether SeAgo and LrAgo have preference for specific genomic regions or

sequence motifs, we checked whether they were loaded with smDNAs during their expression

in the heterologous

E. coli

host.

Electrophoretic analysis of nucleic acids co-purified with

SeAgo

and LrAgo revealed that both pAgos were associated with 14-18 nt smDNAs (Fig. S3B). We

sequenced libraries of pAgo-associated smDNAs obtained from late logarithmic or stationary

bacterial cultures (for 5.5 and 12.5 h time points, Fig. S3A) in the absence or in the presence of

ciprofloxacin and analyzed the distribution of smDNAs along the chromosomal and plasmid

DNA.

Sequence analysis of smDNAs confirmed that the majority of smDNA associated with SeAgo and

LrAgo have the length of 15-19 nt and 14-19 nt, respectively (Fig. 4A, top). Except of slight

preference for G at the first guide position in the case of SeAgo, no strong nucleotide biases

were found along the guide length. The mean GC-content of smDNAs corresponded to genomic

DNA of

E. coli

(~51%), and it was only slightly increased at the first guide position for SeAgo and

slightly decreased upstream of the guide 5’-end and around 10-15 guide nucleotides for LrAgo

(Fig. 4A, bottom). Overall, this analysis suggests that both SeAgo and LrAgo have no specific

motif preferences and can likely interact with guide DNAs of any sequence.

Similarly to several previously studied pAgos, both SeAgo and LrAgo were enriched with

smDNAs derived from plasmid DNA (11-14-fold enrichment over chromosomal DNA for SeAgo

and 3-9-fold preference for LrAgo, after accounting for the relative replicon lengths and the

plasmid copy number, 12 for pBAD). A similar bias for plasmid DNA was observed in the

presence of ciprofloxacin (Table S1). Nevertheless, the majority of smDNA guides (78-95% in

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

various experiments, Table S1) were derived from the

E. coli

chromosome indicating that

genomic DNA is efficiently targeted by both pAgos.

The distribution of smDNA guides along the chromosome was highly uneven, with two large

peaks at the

terA

and

terC

sites of replication termination for both pAgos (Fig. 4B, Fig. 5A). In

addition, two smaller peaks were present at the next pair of

ter

sites,

terB

and

terD

(Fig. 5A).

For SeAgo, similar targeting of the

ter

sites was observed at different stages of cell growth. For

LrAgo, targeting of the

ter

sites was less efficient at the logarithmic stage but was increased in

the stationary culture (Fig. 5A).

The outer edges of the smDNA peaks precisely correspond to the

ter

motifs in chromosomal

DNA bound by Tus protein (Fig. 5A). The inner borders of the peaks coincide with the properly

oriented Chi-sites in each genomic strand (the closest sites in the plus strand for

terC

and in the

minus strand for

terA

). Chi-sites (5′-GCTGGTGG-3′ in

E. coli

) serve as stop-signals for the RecBCD

helicase-nuclease during processing of double-strand DNA breaks. This suggests that smDNAs

are produced with participation of RecBCD from double-strand DNA ends that are formed after

stalling of the replication fork at Tus-bound

ter

sites. In a further support for this notion, the

ratio of smDNAs loaded from the plus and minus genomic strands in the

ter

region was

asymmetric depending on the orientation of the

ter

sites. For both

terA

and

terC

(and

terB

more smDNAs were produced from the DNA strand with the 3’-end oriented toward the

ter

site

(from the minus genomic strand for

terA

and from the plus strand for

terC

;

2-3-fold more than

from corresponding 5’-terminated DNA strands). This corresponds to the asymmetry in smDNA

processing by RecBCD previously reported for another pAgo protein, CbAgo (31).

Targeting of the

ter

region by both SeAgo and LrAgo was increased in the presence of

ciprofloxacin (Fig. 5A). Specifically, the fraction of smDNAs from

terA

was increased ~2.6-fold

and 3.9-fold for SeAgo and LrAgo, respectively, at the logarithmic stage of growth, and 2.4-fold

and 2.9-fold at the stationary stage of growth (Fig. 5A). Furthermore, ciprofloxacin changed the

relative sizes of the smDNA peaks at

terA

and

terC

. In the absence of ciprofloxacin, the peak at

terC

was larger than at

terA

for both pAgos at both stages of growth (Fig. 5A). This corresponds

to the shorter length of the rightward replichore that terminates at

terC

and indicates that

smDNAs at

ter

sites are likely produced during replication termination, which is more frequent

terC

(31, 37).

In contrast, the peaks at

terA

and

terC

were

comparable in the presence of

ciprofloxacin, because smDNA loading was stimulated to a higher extent at

terA

than at

terC

(Fig. 5A). For both pAgos, this effect became especially prominent in stationary cultures. This

indicates that the relative frequencies of replication termination at

terA

and

terC

may be

leveled in the presence of ciprofloxacin, or that the efficiency of smDNA processing in these

regions may become less dependent on replication in these conditions.

To further explore the role of the RecBCD machinery in the processing of smDNAs guides, we

calculated the distribution of smDNAs around Chi sites throughout the whole chromosome

excluding the

ter

region. This metaplot analysis revealed that distribution pAgo-bound smDNA

guides was asymmetric and dependent on the orientation relative to the Chi site. For the DNA

strand co-oriented with Chi, the amounts of smDNAs derived from the 3’-side of Chi were much

higher than from the 5’-side, with an abrupt drop immediately at the Chi sequence (Fig. 6,

green). For the DNA strand that was oriented in the opposite direction relative to Chi, the

changes in the amounts of smDNAs around Chi were much less pronounced (Fig. 6, gray). This

indicates that smDNAs are preferentially generated from the 3’-terminated DNA strand during

processing of double-strand ends by RecBCD, which stops at Chi sites.

For both pAgos, the asymmetry of smDNA loading around Chi sites was increased in the

presence of ciprofloxacin. These changes were reproducible in two independent replicate

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

experiments. In particular, the drop in the amounts of smDNAs upstream of the Chi motif was

changed from 0.77 to 0.62 for SeAgo and from 0.89 to 0.81 for LrAgo in the logarithmic phase

of growth (average from two replicates) (Fig. 6). This suggested that ciprofloxacin stimulates

RecBCD-dependent processing of smDNAs, likely by increasing the number of DSBs formed in

the chromosomal DNA due to inhibition of topoisomerases.

Finally, to explore possible connection of smDNA processing to replication, we compared the

ratio of pAgo-bound smDNAs produced from the plus and minus genomic strands (Fig. 5B). In

the case of SeAgo ciprofloxacin increased generation of smDNAs from the leading DNA strand

in both replichores, resulting in an increased ratio (>1) of smDNAs corresponding to the plus

and minus strands for the rightward replichore and a decreased ratio (<1) for the leftward

replichore (Fig. 5B). In the

ter

region, this ratio was also changed in favor of the 3’-terminated

strand at each

ter

site for both pAgos (<1 for

terA

and >1 for

terC

). This correlates with the

observed increase in asymmetry of smDNA processing around Chi sites, which are mostly co-

oriented with replication, and suggests that both changes result from increased stalling of

replication forks in the presence of ciprofloxacin , followed by their processing by RecBCD.

Distribution of pAgo-associated smDNAs relative to coding regions

In vitro

experiments with several pAgo proteins, including TtAgo, CbAgo and LrAgo,

demonstrated that their ability to process double-stranded DNA depends on DNA supercoiling

(22, 24, 29). Our results indicate that gyrase inhibition, which changes the supercoiling state of

the chromosome, also changes the distribution of smDNAs. Another factor that could

potentially affect smDNA processing by changing DNA supercoiling is transcription, which

induces positive supercoils in front of the moving RNA polymerase and negative supercoils

behind of it (38-41). To explore the role of transcription in the targeting of chromosomal DNA

by pAgos, we first compared the abundances of pAgo-associated smDNAs derived from each

genomic strand for genes co-directed or oppositely directed relative to replication. No

differences between these groups of genes were found for either SeAgo or LrAgo (Fig. S4A).

We then analyzed smDNA abundance in intergenic DNA regions for divergent, convergent and

co-oriented gene pairs. Divergent and convergent gene orientation is associated with negative

and positive DNA supercoiling in intergenic regions, respectively, which could affect smDNA

production (38). No significant differences in the amounts of smDNAs were detected for the

different types of gene pairs for both pAgos (Fig. S4B) suggesting that transcription is unlikely to

have major effects on smDNA biogenesis.

Analysis of the effects of ciprofloxacin and SeAgo on cell division in

S. elongatus

The experiments presented above demonstrated that pAgo proteins from mesophilic

cyanobacteria can suppress defects in DNA replication in

E. coli

caused by gyrase inhibition. To

test whether these pAgos can have similar functions in their native species, we compared

elongatus

strains with the natural level of expression of SeAgo (wild-type strain), without SeAgo

(

∆

SeAgo), and with an increased level of SeAgo, expressed from a strong constitutive promoter

(

↑

SeAgo). Titration of ciprofloxacin demonstrated that growth of all three strains in liquid

culture was fully inhibited at

≥

15 ng/ml of the antibiotic, indicating that

S. elongatus

sensitive to ciprofloxacin than

E. coli

. We then compared cell growth at sublethal ciprofloxacin

concentrations. Wild-type and

∆

SeAgo strains had identical growth kinetics in the absence and

in the presence of 10 ng/ml of ciprofloxacin (Fig. 7A). In contrast, the growth of the strain with

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

increased SeAgo expression was strongly inhibited in the presence of ciprofloxacin. Microscopy

analysis revealed no changes in the cell number or morphology in either wild-type or

∆

SeAgo

strains in these conditions (Fig. 7B). Cell morphology also remained unchanged in the case of

the SeAgo overexpressing strain, despite the lower number of cells observed in the presence of

ciprofloxacin (Fig. 7B). Thus, ciprofloxacin inhibits

S. elongatus

growth without formation of

multicellular filaments, suggesting that its mechanism of action in cyanobacterial cells may be

different from

E. coli

. SeAgo does not increase the resistance of the wild-type strain of

elongatus

to ciprofloxacin in comparison with the deletion strain, while its overexpression is

toxic in the presence of the antibiotic.

DISCUSSION

In contrast to eAgos that recognize RNA targets, the majority of studied pAgos preferentially

target DNA

in vitro

and

in vivo

, suggesting that their mechanism of action is different from

eAgos. Recently, a novel group of pAgos was shown to use DNA guides to recognize RNA targets

(42, 43), but their functional activities

in vivo

remain to be investigated. Studied pAgos were

shown to target foreign genetic elements in bacterial cells (22, 26, 28, 29, 31), suggesting that

the defensive function of Ago proteins is conserved between prokaryotes and eukaryotes (44).

At the same time, it was suggested that pAgos might play other roles, including the regulation

of gene expression, participation in cellular suicide systems and DNA repair (20, 26, 45-48).

Indeed, TtAgo from

T. thermophilus

was recently demonstrated to participate in separation of

chromosomal DNA during replication (32). This activity of TtAgo became crucial for cell division

when DNA gyrase - the sole type II topoisomerase in

T. thermophilus

- was inhibited by

ciprofloxacin. It was shown that TtAgo is associated with small guide DNAs corresponding to the

termination region of replication and can be co-precipitated with several proteins involved in

DNA processing, including gyrase and factors involved in DNA recombination (AddAB, a RecBCD

homolog in

T. thermophilus

). It was therefore proposed that TtAgo helps to decatenate

daughter chromosomes by direct DNA cleavage and/or by recruiting accessory factors to the

termination region (32).

Here, we have demonstrated that two pAgo proteins from mesophilic cyanobacteria, SeAgo

and LrAgo, facilitate cell division and prevent formation of multinucleated cell filaments in the

presence of ciprofloxacin in

E. coli

. The primary target of ciprofloxacin in

E. coli

is gyrase (49-

52), and

both pAgos also suppress a milder phenotype caused by dCas9 knockdown of gyrase

expression in

E. coli

Inhibition of gyrase is known to strongly affect replication by changing DNA

supercoiling and integrity, and by introducing direct roadblocks to the moving replisomes (52-

55). Thus, formation of cell filaments in the presence of ciprofloxacin can be explained by

failure to separate daughter chromosomes due to their incomplete replication and

decatenation, and by the induction of the SOS response after DNA damage, preventing cell

division (55-60).

SeAgo and LrAgo may help the cells to complete DNA replication by direct targeting of

chromosomal DNA through their nuclease activity. In support of this proposal, we found that

both SeAgo and LrAgo preferentially target the replication termination region of the

E. coli

chromosome and are loaded with small guide DNAs corresponding to the

ter

sites. The stronger

effects of SeAgo on cell growth and morphology in the presence of ciprofloxacin (Fig. 2 and Fig.

3) correlate with its higher loading with smDNAs from the

ter

sites and a stronger asymmetry of

smDNA processing around Chi sites and across the chromosome. Recent work by Jolly et al.

suggested that TtAgo may recruit gyrase and double-strand break repair factors to the

ter

region in

T. thermophilus

(32). In comparison, SeAgo and LrAgo are not expected to specifically

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

interact with host-specific factors in heterologous

E. coli

suggesting that they directly

participate in chromosomal DNA processing. In particular, pAgos may introduce single-strand or

double-strand breaks in the

ter

region when loaded with corresponding smDNAs, thus

decreasing the level of unfavorable positive DNA supercoiling between the converging

replisomes and/or assisting decatenation of the sister chromosomes in the presence of

topoisomerase inhibitors. DNA decatenation requires introducing double-strand breaks into

chromosomal DNA, and the anti-inhibitory function of pAgos indeed depends on the

homologous recombination machinery and is not observed in

E. coli

strains lacking the key

components of double-strand break repair, RecBCD or RecA. Further experiments are required

to decipher the interplay between pAgos and the recombination machinery in various species.

Similar enrichment of pAgo-associated smDNAs at the

ter

sites in the chromosomal termination

region was previously observed for TtAgo in

T. thermophilus

(32) and for CbAgo expressed in

coli

(31). Thus, different pAgo proteins have similar chromosomal preferences, indicating that

the ability to recognize the sites of replication termination may be a common feature of pAgo

proteins from various branches of the pAgo tree. This specificity is likely determined by the

mechanism of replication termination and may be different in various species. Indeed, a

different pattern of smDNA distribution is observed for SeAgo in its native host

S. elongatus

which lacks recognizable

ter

sites in the chromosome (25).

In the

ter

region, smDNAs loaded into pAgos are preferentially generated from 3’-ends of DNA

strands oriented toward

ter

sites, and smDNA processing is confined to the areas between

ter

sites and the closest Chi sites. Furthermore, smDNA processing throughout the genome outside

of the

ter

region also depends on the position and orientation of Chi sites. At the same time,

smDNA biogenesis does not significantly depend on the orientation of transcription units

relative to each other or to the direction of replication. The observed pattern of smDNA

processing from the

ter

region and its dependence on Chi sites indicate that smDNAs are

produced during asymmetric cleavage of the two DNA strands by RecBCD or other cellular

nucleases that cooperate with RecBCD during DNA unwinding (31, 33-35). The efficiency of

smDNA processing from the

ter

region relative to other regions of the chromosome and the

asymmetry of smDNA processing around Chi sites are increased in the presence of

ciprofloxacin, possibly as a result of increased levels of gyrase-mediated DNA fragmentation

induced by the antibiotic. This may result in increased targeting of the

ter

region by guide-

loaded pAgos and help to overcome problems with chromosomal DNA processing during final

steps of replication.

Strikingly, while SeAgo protects

E.coli

cells from the toxic effects of ciprofloxacin, it does not

defend its host strain of

S. elongatus

. Moreover, overexpression of SeAgo makes

S. elongatus

more susceptible to this antibiotic. This may be explained by a different pattern of

chromosomal targeting by SeAgo in

S. elongatus

(25) in comparison with

E. coli

and/or by

differences in the mechanism of inhibition of cell division by ciprofloxacin in cyanobacteria. In

particular, cyanobacteria do not have classical SOS response characterized in

E. coli

, and

elongatus

apparently lacks its master regulator, the LexA repressor (61, 62). SeAgo may

therefore increase DNA damage rather than aid DNA processing in

S. elongatus

cells treated

with ciprofloxacin.

Natural functions of SeAgo in cyanobacterial cells remain to be investigated. We have

previously shown that its deletion or overexpression do not affect the kinetics of cell growth

under laboratory conditions (25). At the same time, loss of function of SeAgo was shown to

increase the efficiency of plasmid DNA transfer (63, 64). SeAgo may therefore modulate natural

transformation in its host bacterium. Our findings suggest that the functions of pAgo proteins

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

may change upon their transfer between prokaryotic species and switch between cell

protection, regulation of horizontal gene transfer, and processing and repair of chromosomal

DNA.

MATERIALS AND METHODS

Plasmids and strains

All

E. coli

strains were isogenic to

E. coli

BL21(DE3).

recA-

minus and

recBD-

minus strains were

obtained previously (31).

E. coli

cells were routinely cultivated in LB Miller broth (2% tryptone,

0.5% yeast extract, 1% NaCl, pH 7.0) with the addition of ampicillin (100 μg/ml) if needed. The

gene of SeAgo (WP_011378069.1) was codon-optimized using IDT Codon Optimization Tool for

expression in

E. coli

, synthesized by the IDT core facility, and cloned into pBAD-HisB in frame

with the N-terminal His6-tag. The pBAD plasmid encoding LrAgo was obtained previously (24).

E. coli

strains were transformed with pBAD plasmids encoding each of the two pAgos or a

control plasmid without pAgo, grown overnight in LB with ampicillin, diluted twice with 50%

glycerol, aliquoted, frozen in liquid nitrogen and stored at −80°C.

Ciprofloxacin treatment and analysis of growth kinetics in

E. coli

To determine sublethal ciprofloxacin concentrations, overnight bacterial culture of BL21(DE3)

carrying the control pBAD vector without pAgo genes was obtained from the frozen aliquoted

culture and inoculated into 100 μl of fresh LB medium supplemented with ciprofloxacin (0, 0.1,

0.3, 0.5 μg/ml), 0.01% L-arabinose and ampicillin in 96-well plates. The plates were incubated at

300 rpm at 30 °C in a CLARIOSTAR microplate reader and cell density was monitored by

measuring OD

600

every 10 min. Three independent biological replicates were performed.

For analysis of the effects of pAgos on the growth kinetics, overnight bacterial cultures were

obtained from frozen aliquoted cultures and inoculated into 100 μl of fresh LB medium

supplemented with 0 or 0.5 μg/ml ciprofloxacin, 0.01% L-arabinose to induce pAgo expression

and ampicillin in 96-well plates (TPP, flat bottom). The plates were incubated at 300 rpm at

30°C in a CLARIOSTAR microplate reader and cell density was monitored by measuring OD

600

every 10 min. Three independent biological replicates were performed. Additionally, after 4.5

hours cells were harvested for Western blot analysis, microscopy and determination of CFU

numbers. To calculate CFU,

serial dilutions of the culture were plated on selective agar medium

containing

ampicillin

Western blotting

The levels of SeAgo and LrAgo expression were determined by Western blotting.

E. coli

cells

expressing pAgos were harvested by centrifugation, the pellet was mixed with 1

Laemmli

sample buffer (120 mM Tris-HCl, 4% SDS, 4% β-mercaptoethanol, 10% glycerol, pH 6.8) and

heated at 95 °C for 5 min, and the samples were resolved by electrophoresis in a 4–20% Tris-

glycine gel (BioRad). Proteins were transferred onto a nitrocellulose membrane in Towbin

transfer buffer (25 mM Tris, 192 mM glycine, 20% methanol) using semi-dry procedure at 25 V,

1 A for 30 min (BioRad Trans-Blot Turbo). The transfer membrane was washed in PBS (10 mM

phosphate buffer, 137 mM NaCl, 2.7 mM KCl) for 5 min. The membrane was blocked with

blocking buffer (PBS, Tween-20 0.1% (v/v), non-fat milk 5% (w/v) for 30 min at room

temperature, and then incubated with anti-His6 monoclonal antibodies (1:1,000, Sigma) for 1 h

at room temperature. The membrane was washed four times with PBST buffer (PBS, Tween-20

0.1% (v/v)), and incubated with HRP-conjugated anti-mouse secondary antibodies (1:10,000,

Sigma) for 1 h at room temperature and washed again as described above. Antigen–antibody

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

complexes were detected with Immobilon ECL Ultra Western HRP substrate (Millipore) on a

Chemidoc XRS+ imager (BioRad).

Preparative growth of

E. coli

and purification and sequencing of pAgo-associated smDNAs

Overnight bacterial cultures were obtained from frozen aliquoted cultures and inoculated into

500 ml of fresh LB medium supplemented with 0 or 0.3 μg/ml ciprofloxacin, 0.01% L-arabinose

and ampicillin in 2 liter flasks. The flasks were incubated at 190 rpm at 30°C in an orbital shaker

and cell density was monitored by measuring OD

600

every 30 min. Two independent biological

replicates were performed. The cells were harvested by centrifugation at 7,000g, 4 °C for 15

min after 5.5 and 12.5 hours of growth for protein pull-down. The cells were disrupted with a

high-pressure homogenizer (EmulsiFlex-C5, Avestin) at 18000 psi. pAgos were pulled down

using Co

-Talon Metal Affinity Resin (Takara) as described previously (26). Eluted proteins were

treated with Proteinase K for 30 minutes at 37°C, small nucleic acids were extracted with

phenol-chloroform, ethanol-precipitated, dissolved in water and analyzed by PAGE as described

(26).

Libraries for high-throughput sequencing of smDNAs were prepared according to the previously

published splinted ligation protocol (26). Briefly, nucleic acids extracted from pAgos were

treated with RNase A (Thermo Fisher), purified by PAGE, small DNAs (14-20 nt) were eluted

from the gel in 0.4 M NaCl overnight at 21 °C, ethanol precipitated, dissolved in water,

phosphorylated with polynucleotide kinase (New England Biolabs), and ligated with adaptor

oligonucleotides using bridge oligonucleotides as described in (26). The ligated DNA fragments

were purified by denaturing PAGE, amplified, and indexed by the standard protocol for small

RNA sequencing (New England Biolabs). Small DNA libraries were sequenced using the

HiSeq2500 platform (Illumina) in the rapid run mode (50-nucleotide single-end reads). The list

of all sequenced smDNA libraries is presented in Table S1.

Analysis of chromosomal distribution of smDNAs

Analysis of smDNA sequences was performed as described previously (31). After trimming the

adaptors, reads shorter than 14 nt were removed with CutAdapt (v. 2.8). Bowtie (v. 1.2.3) was

used to align the reads to the reference genomic DNA (Refseq accession number NC_012971.2)

with no mismatches allowed. Genome coverage was calculated using BEDTools (v. 2.27.1) and

custom Python scripts. Whole-genome coverage of each DNA strand was calculated in 1000 nt

windows and normalized by the total number of mapped reads in the library, expressed as

RPKM (reads per kilobase per million mapped reads). To calculate the percent of reads mapped

to the regions around

ter

-sites, the number of smDNAs for each DNA strand from each region

(from 1328000 to 1350000 for

terA

, from 1524000 to 1557000 for

terC

, and from 1626000 to

1629000 for

terB

) was divided by the total number of reads mapped to both strand of the

genome. The ratio between the coverage of plus-strand and minus-strand from the

ciprofloxacin-treated cell culture was divided by the same ratio obtained for the control library

and plotted as a rolling mean (50 kb window, 10 kb step). To calculate smDNA distribution

around Chi-sites, in genes and in intergenic intervals, the region of replication termination (1.2-

1.7 Mb chromosomal coordinates) was removed from the analysis. Coverage of the regions

around Chi-sites was calculated in 500-nt bins and then averaged. Gene borders were extracted

from the Refseq annotation file. Intergenic intervals with length < 500 nt were classified into

four groups depending on the relative orientation of the surrounding gene, and 100 nucleotides

were additionally included from each side to each interval. SmDNA coverage of genes and

intergenic intervals was calculated in RPKM. Nucleotide logos were calculated using reads

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

longer than 16 nt, and reads longer than 17 nt were truncated to 17 nt from the 3’-end. All

plots were generated in R (v. 3.6.3) using ggplot2 (v. 3.3.3) and ggseqlogo (v. 0.1) (65) libraries.

Strains of

S. elongatus

, growth conditions and ciprofloxacin titration

Wild-type strain of

S. elongatus

PCC 7942 was obtained from Invitrogen. Strains with deletion

and overexpression of

ago

gene were obtained previously using standard protocols (25).

Cyanobacterial strains were maintained in liquid BG11 with shaking or on solid BG11 plates (66)

under continuous light conditions (~250 μE m

−2

−1

) at 30°C with appropriate antibiotics (10

μg/ml spectinomycin) if needed.

Dense cultures of

S. elongatus

wild-type and mutant strains were inoculated into 800 μl of fresh

BG11 medium supplemented with 0-35 ng/ml ciprofloxacin and spectinomycin (in the case of

the mutant strains) in 48-well plates (Eppendorf). The plates were incubated at 300 rpm at 30°C

under continuous light conditions and cell density was monitored by measuring OD

750

every 12

hours. One biological replicate was performed for titration and three independent biological

replicates were performed for growth experiment with 0 and 10 ng/ml ciprofloxacin. Cells were

harvested for microscopy 48 hours after inoculation.

Cell microscopy

E. coli

cells were visualized using acridine orange staining. Sterilized slide was fixed with 95%

ethanol for 2 minutes. Excess ethanol was drained, and slide is allowed to air-dry. The bacterial

culture was placed onto the slide, dried and fixed. Slide was flooded with acridine orange stain

for 2 minutes, rinsed thoroughly with tap water, and allowed to air-dry. Cell pictures were

taken on a ZEISS LSM 900 confocal laser scanning microscope (Carl Zeiss) with a 63

oil

immersion objective and with 100-μm confocal pinhole aperture. Cell pictures of

S. elongatus

were taken similarly but using chlorophyll autofluorescence, which was excited at 488 nm and

recorded using a 650 nm long-pass filter. The obtained pictures were processed using the ZEN

Microscopy software (Carl Zeiss).

Gyrase knockdown with dCas9

To knockdown

gyrA

gene, a plasmid carrying the pA15 origin, chloramphenicol resistance and

dCas9 genes, and sgRNA was assembled. The 20 nt guide sequence in sgRNA corresponding to

the

gyrA

gene (5’-AGCTCTTCCTCAATGTTGAC-3’) was chosen based on the algorithm developed

in (67).

E. coli

Bl21(DE3) strains containing pBAD plasmids encoding or lacking pAgos were

transformed with the dCas9 plasmid and grown under standard conditions. The drop of the

gyrA

expression level was measured by quantitative PCR using primers corresponding to the

gyrA

gene (qPCR_gyrA_for 5’-TTATGACACGATCGTCCGTATG and qPCR_gyrA_rev 5’-

TTCCGTGCCGTCATAGTTATC) and the

rpoB

gene for normalization (rpoB_Fw1 5’-

ATGGTTTACTCCTATACCGAGAAAAAAC and rpoB_Rv1 5’-TATTGCAGCTCGGAATTACCG).

AUTHOR CONTRIBUTIONS

Andrey Kulbachinskiy and Alexei Aravin conceived the study, Anna Olina performed

experiments, Aleksei Agapov performed bioinformatic analysis of small DNA libraries, Denis

Yudin made the original discovery of the chromosomal specificity of pAgos under supervision of

Anton Kuzmenko and performed initial analysis of small DNAs, Anna Olina and Aleksei Agapov

prepared the figures, Andrey Kulbachinskiy wrote the manuscript with contributions from all

the authors.

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

ACKNOWLEDGMENTS

We thank Daria Esyunina for continued advice on this study, Phillip Zamore, Samson M. Jolly

and Dmitry Sutormin for helpful discussions. This work was supported by grant 19-14-00359 of

the Russian Science Foundation to Daria Esyunina. The authors declare no competing interests.

DATA AVAILABILITY

The smDNA sequencing datasets generated in this study are available from the Sequence Read

Archive (SRA) database under bioproject number PRJNA878808. The code used for data

analysis is available at the GitHub repository at

https://github.com/AlekseiAgapov/SeAgo_LrAgo. All primary data are available from the

corresponding author upon request.

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

REFERENCES

1. Makarova KS, Wolf YI, van der Oost J, Koonin EV.

2009. Prokaryotic homologs of Argonaute

proteins are predicted to function as key components of a novel system of defense against

mobile genetic elements. Biol Direct 4:29.

2. Swarts DC, Makarova K, Wang Y, Nakanishi K, Ketting RF, Koonin EV, Patel DJ, van der Oost J.

2014. The evolutionary journey of Argonaute proteins. Nat Struct Mol Biol 21:743-753.

3. Hall TM.

2005. Structure and function of argonaute proteins. Structure 13:1403-8.

4. Ghildiyal M, Zamore PD.

2009. Small silencing RNAs: an expanding universe. Nat Rev Genet

10:94-108.

5. Hammond SM, Boettcher S, Caudy AA, Kobayashi R, Hannon GJ.

2001. Argonaute2, a link

between genetic and biochemical analyses of RNAi. Science 293:1146-50.

6. Martinez J, Patkaniowska A, Urlaub H, Luhrmann R, Tuschl T.

2002. Single-stranded antisense

siRNAs guide target RNA cleavage in RNAi. Cell 110:563-74.

7. Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G, Tuschl T.

2004. Human Argonaute2

mediates RNA cleavage targeted by miRNAs and siRNAs. Mol Cell 15:185-97.

8. Joshua-Tor L.

2006. The Argonautes. Cold Spring Harb Symp Quant Biol 71:67-72.

9. Peters L, Meister G.

2007. Argonaute proteins: mediators of RNA silencing. Mol Cell 26:611-23.

10. Pratt AJ, MacRae IJ.

2009. The RNA-induced silencing complex: a versatile gene-silencing

machine. J Biol Chem 284:17897-901.

11. Olina AV, Kulbachinskiy AV, Aravin AA, Esyunina DM.

2018. Argonaute Proteins and Mechanisms

of RNA Interference in Eukaryotes and Prokaryotes. Biochemistry (Mosc) 83:483-497.

12. Parker JS, Roe SM, Barford D.

2004. Crystal structure of a PIWI protein suggests mechanisms for

siRNA recognition and slicer activity. EMBO J 23:4727-4737.

13. Song JJ, Smith SK, Hannon GJ, Joshua-Tor L.

2004. Crystal structure of Argonaute and its

implications for RISC slicer activity. Science 305:1434-1437.

14. Ma JB, Yuan YR, Meister G, Pei Y, Tuschl T, Patel DJ.

2005. Structural basis for 5'-end-specific

recognition of guide RNA by the A. fulgidus Piwi protein. Nature 434:666-670.

15. Parker JS, Roe SM, Barford D.

2005. Structural insights into mRNA recognition from a PIWI

domain-siRNA guide complex. Nature 434:663-666.

16. Yuan YR, Pei Y, Ma JB, Kuryavyi V, Zhadina M, Meister G, Chen HY, Dauter Z, Tuschl T, Patel DJ.

2005. Crystal structure of A. aeolicus argonaute, a site-specific DNA-guided endoribonuclease,

provides insights into RISC-mediated mRNA cleavage. Mol Cell 19:405-419.

17. Wang Y, Juranek S, Li H, Sheng G, Tuschl T, Patel DJ.

2008. Structure of an argonaute silencing

complex with a seed-containing guide DNA and target RNA duplex. Nature 456:921-926.

18. Wang Y, Juranek S, Li H, Sheng G, Wardle GS, Tuschl T, Patel DJ.

2009. Nucleation, propagation

and cleavage of target RNAs in Ago silencing complexes. Nature 461:754-761.

19. Ryazansky S, Kulbachinskiy A, Aravin AA.

2018. The Expanded Universe of Prokaryotic Argonaute

Proteins. MBio 9:e01935-18.

20. Willkomm S, Makarova K, Grohmann D.

2018. DNA-silencing by prokaryotic Argonaute proteins

adds a new layer of defence against invading nucleic acids. FEMS Microbiol Rev 42:376-387.

21. Cao Y, Sun W, Wang J, Sheng G, Xiang G, Zhang T, Shi W, Li C, Wang Y, Zhao F, Wang H.

2019.

Argonaute proteins from human gastrointestinal bacteria catalyze DNA-guided cleavage of

single- and double-stranded DNA at 37 degrees C. Cell Discov 5:38.

22. Hegge JW, Swarts DC, Chandradoss SD, Cui TJ, Kneppers J, Jinek M, Joo C, van der Oost J.

2019.

DNA-guided DNA cleavage at moderate temperatures by Clostridium butyricum Argonaute.

Nucleic Acids Res 47:5809-5821.

23. Kaya E, Doxzen KW, Knoll KR, Wilson RC, Strutt SC, Kranzusch PJ, Doudna JA.

2016. A bacterial

Argonaute with noncanonical guide RNA specificity. Proc Natl Acad Sci U S A 113:4057-4062.

24. Kuzmenko A, Yudin D, Ryazansky S, Kulbachinskiy A, Aravin AA.

2019. Programmable DNA

cleavage by Ago nucleases from mesophilic bacteria Clostridium butyricum and Limnothrix

rosea. Nucleic Acids Res 47:5822-5836.

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

25. Olina A, Kuzmenko A, Ninova M, Aravin AA, Kulbachinskiy A, Esyunina D.

2020. Genome-wide

DNA sampling by Ago nuclease from the cyanobacterium Synechococcus elongatus. RNA Biol

doi:10.1080/15476286.2020.1724716:1-12.

26. Olovnikov I, Chan K, Sachidanandam R, Newman DK, Aravin AA.

2013. Bacterial argonaute

samples the transcriptome to identify foreign DNA. Mol Cell 51:594-605.

27. Sheng G, Zhao H, Wang J, Rao Y, Tian W, Swarts DC, van der Oost J, Patel DJ, Wang Y.

2014.

Structure-based cleavage mechanism of Thermus thermophilus Argonaute DNA guide strand-

mediated DNA target cleavage. Proc Natl Acad Sci U S A 111:652-657.

28. Swarts DC, Hegge JW, Hinojo I, Shiimori M, Ellis MA, Dumrongkulraksa J, Terns RM, Terns MP,

van der Oost J.

2015. Argonaute of the archaeon Pyrococcus furiosus is a DNA-guided nuclease

that targets cognate DNA. Nucleic Acids Res 43:5120-5129.

29. Swarts DC, Jore MM, Westra ER, Zhu Y, Janssen JH, Snijders AP, Wang Y, Patel DJ, Berenguer J,

Brouns SJJ, van der Oost J.

2014. DNA-guided DNA interference by a prokaryotic Argonaute.

Nature 507:258-261.

30. Zander A, Willkomm S, Ofer S, van Wolferen M, Egert L, Buchmeier S, Stockl S, Tinnefeld P,

Schneider S, Klingl A, Albers SV, Werner F, Grohmann D.

2017. Guide-independent DNA cleavage

by archaeal Argonaute from Methanocaldococcus jannaschii. Nat Microbiol 2:17034.

31. Kuzmenko A, Oguienko A, Esyunina D, Yudin D, Petrova M, Kudinova A, Maslova O, Ninova M,

Ryazansky S, Leach D, Aravin AA, Kulbachinskiy A.

2020. DNA targeting and interference by a

bacterial Argonaute nuclease. Nature 587:632-637.

32. Jolly SM, Gainetdinov I, Jouravleva K, Zhang H, Strittmatter L, Bailey SM, Hendricks GM,

Dhabaria A, Ueberheide B, Zamore PD.

2020. Thermus thermophilus Argonaute Functions in the

Completion of DNA Replication. Cell 182:1545-1559 e18.

33. Dillingham MS, Kowalczykowski SC.

2008. RecBCD enzyme and the repair of double-stranded

DNA breaks. Microbiol Mol Biol Rev 72:642-71.

34. Smith GR.

2012. How RecBCD enzyme and Chi promote DNA break repair and recombination: a

molecular biologist's view. Microbiol Mol Biol Rev 76:217-28.

35. Wigley DB.

2013. Bacterial DNA repair: recent insights into the mechanism of RecBCD, AddAB

and AdnAB. Nat Rev Microbiol 11:9-13.

36. Diver JM, Wise R.

1986. Morphological and biochemical changes in Escherichia coli after

exposure to ciprofloxacin. J Antimicrob Chemother 18 Suppl D:31-41.

37. Duggin IG, Bell SD.

2009. Termination structures in the Escherichia coli chromosome replication

fork trap. J Mol Biol 387:532-9.

38. Sutormin D, Galivondzhyan A, Musharova O, Travin D, Rusanova A, Obraztsova K, Borukhov S,

Severinov K.

2022. Interaction between transcribing RNA polymerase and topoisomerase I

prevents R-loop formation in E. coli. Nat Commun 13:4524.

39. Sutormin D, Rubanova N, Logacheva M, Ghilarov D, Severinov K.

2019. Single-nucleotide-

resolution mapping of DNA gyrase cleavage sites across the Escherichia coli genome. Nucleic

Acids Res 47:1373-1388.

40. Wu HY, Shyy SH, Wang JC, Liu LF.

1988. Transcription generates positively and negatively

supercoiled domains in the template. Cell 53:433-40.

41. Liu LF, Wang JC.

1987. Supercoiling of the DNA template during transcription. Proc Natl Acad Sci

U S A 84:7024-7.

42. Li W, Liu Y, He R, Wang L, Wang Y, Zeng W, Zhang Z, Wang F, Ma L.

2022. A programmable pAgo

nuclease with RNA target preference from the psychrotolerant bacterium Mucilaginibacter

paludis. Nucleic Acids Res 50:5226-5238.

43. Lisitskaya L, Shin Y, Agapov A, Olina A, Kropocheva E, Ryazansky S, Aravin AA, Esyunina D,

Murakami KS, Kulbachinskiy A.

2022. Programmable RNA targeting by bacterial Argonaute

nucleases with unconventional guide binding and cleavage specificity. Nat Commun 13:4624.

44. Koonin EV.

2017. Evolution of RNA- and DNA-guided antivirus defense systems in prokaryotes

and eukaryotes: common ancestry vs convergence. Biol Direct 12:5.

45. Lisitskaya L, Aravin AA, Kulbachinskiy A.

2018. DNA interference and beyond: structure and

functions of prokaryotic Argonaute proteins. Nat Commun 9:5165.

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

46. Swarts DC, Koehorst JJ, Westra ER, Schaap PJ, van der Oost J.

2015. Effects of Argonaute on

Gene Expression in Thermus thermophilus. PLoS One 10:e0124880.

47. Koopal B, Potocnik A, Mutte SK, Aparicio-Maldonado C, Lindhoud S, Vervoort JJM, Brouns SJJ,

Swarts DC.

2022. Short prokaryotic Argonaute systems trigger cell death upon detection of

invading DNA. Cell 185:1471-1486 e19.

48. Zeng Z, Chen Y, Pinilla-Redondo R, Shah SA, Zhao F, Wang C, Hu Z, Wu C, Zhang C, Whitaker RJ,

She Q, Han W.

2022. A short prokaryotic Argonaute activates membrane effector to confer

antiviral defense. Cell Host Microbe 30:930-943 e6.

49. Blanche F, Cameron B, Bernard FX, Maton L, Manse B, Ferrero L, Ratet N, Lecoq C, Goniot A,

Bisch D, Crouzet J.

1996. Differential behaviors of Staphylococcus aureus and Escherichia coli

type II DNA topoisomerases. Antimicrob Agents Chemother 40:2714-20.

50. Chen CR, Malik M, Snyder M, Drlica K.

1996. DNA gyrase and topoisomerase IV on the bacterial

chromosome: quinolone-induced DNA cleavage. J Mol Biol 258:627-37.

51. Khodursky AB, Zechiedrich EL, Cozzarelli NR.

1995. Topoisomerase IV is a target of quinolones in

Escherichia coli. Proc Natl Acad Sci U S A 92:11801-5.

52. Hooper DC, Jacoby GA.

2016. Topoisomerase Inhibitors: Fluoroquinolone Mechanisms of Action

and Resistance. Cold Spring Harb Perspect Med 6.

53. Pohlhaus JR, Kreuzer KN.

2005. Norfloxacin-induced DNA gyrase cleavage complexes block

Escherichia coli replication forks, causing double-stranded breaks in vivo. Mol Microbiol

56:1416-29.

54. Wentzell LM, Maxwell A.

2000. The complex of DNA gyrase and quinolone drugs on DNA forms a

barrier to the T7 DNA polymerase replication complex. J Mol Biol 304:779-91.

55. Malik M, Zhao X, Drlica K.

2006. Lethal fragmentation of bacterial chromosomes mediated by

DNA gyrase and quinolones. Mol Microbiol 61:810-25.

56. Piddock LJ, Walters RN, Diver JM.

1990. Correlation of quinolone MIC and inhibition of DNA,

RNA, and protein synthesis and induction of the SOS response in Escherichia coli. Antimicrob

Agents Chemother 34:2331-6.

57. Drlica K, Malik M, Kerns RJ, Zhao X.

2008. Quinolone-mediated bacterial death. Antimicrob

Agents Chemother 52:385-92.

58. Dorr T, Lewis K, Vulic M.

2009. SOS response induces persistence to fluoroquinolones in

Escherichia coli. PLoS Genet 5:e1000760.

59. Bos J, Zhang Q, Vyawahare S, Rogers E, Rosenberg SM, Austin RH.

2015. Emergence of antibiotic

resistance from multinucleated bacterial filaments. Proc Natl Acad Sci U S A 112:178-83.

60. Valat C, Hirchaud E, Drapeau A, Touzain F, de Boisseson C, Haenni M, Blanchard Y, Madec JY.

2020. Overall changes in the transcriptome of Escherichia coli O26:H11 induced by a

subinhibitory concentration of ciprofloxacin. J Appl Microbiol 129:1577-1588.

61. Li S, Xu M, Su Z.

2010. Computational analysis of LexA regulons in Cyanobacteria. BMC Genomics

11:527.

62. Domain F, Houot L, Chauvat F, Cassier-Chauvat C.

2004. Function and regulation of the

cyanobacterial genes lexA, recA and ruvB: LexA is critical to the survival of cells facing inorganic

carbon starvation. Mol Microbiol 53:65-80.

63. Gilderman TS. 2020. Exploring the Role of SeAgo in Host Defense and Gene Transfer Processes in

Synechococcus elongatus

PCC 7942. MS Thesis. UC San Diego.

64. Taton A, Erikson C, Yang Y, Rubin BE, Rifkin SA, Golden JW, Golden SS.

2020. The circadian clock

and darkness control natural competence in cyanobacteria. Nat Commun 11:1688.

65. Wagih O.

2017. ggseqlogo: a versatile R package for drawing sequence logos. Bioinformatics

33:3645-3647.

66. Rippka R, Deruelles J, Waterbury JB, Herdman M, Stanier RY.

1979. Generic Assignments, Strain

Histories and Properties of Pure Cultures of Cyanobacteria. Microbiology 111:1-61.

67. Calvo-Villamanan A, Ng JW, Planel R, Menager H, Chen A, Cui L, Bikard D.

2020. On-target

activity predictions enable improved CRISPR-dCas9 screens in bacteria. Nucleic Acids Res 48:e64.

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

Fig. 1. Analysis of pAgo functions in

E. coli

strains expressing plasmid-encoded SeAgo or

LrAgo or containing a control empty plasmid were grown in the absence or in the presence of

ciprofloxacin (Fig. 2), followed by cell microscopy (Fig. 3), CFU counting (Fig. S2), and analysis of

pAgo-associated smDNAs (Figs. 4-6, S3, S4).

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

Fig. 2. Growth of

E. coli

strains lacking or containing pAgos in the absence and in the presence

of ciprofloxacin.

The experiment was performed with wild-type (A) and

rec

-minus strains (B) in

a plate reader. Ciprofloxacin was added to 0.5

g/ml when indicated. Averages and standard

deviations from 3 biological replicates are shown.

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint

Fig. 3. Effects of pAgo expression and gyrase inhibition on

E. coli

cell morphology.

(A)

E. coli

cells

lacking or containing pAgos were grown in the absence (left) or in the presence (right) of

ciprofloxacin. The samples were taken at 4.5 hours from the cultures shown in Fig. 2. (B) Effects

of gyrase (

gyrA

) knockdown on cell morphology. Fluorescence microscopy after acridine orange

staining. The scale bar is 10

CC-BY-NC-ND 4.0 International license

perpetuity. It is made available under a

preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in

The copyright holder for this

this version posted September 20, 2022.

;

https://doi.org/10.1101/2022.09.13.507849

doi:

bioRxiv preprint