nihms307781.pdf

The human commensal

Bacteroides fragilis

binds intestinal

mucin

Julie Y. Huang

a,1

S. Melanie Lee

, and

Sarkis K. Mazmanian

a,*

Division of Biology, California Institute of Technology,1200 E. California Bl., Pasadena, CA

91125, USA

Abstract

The mammalian gastrointestinal tract harbors a vast microbial ecosystem, known as the

microbiota, which benefits host biology.

Bacteroides fragilis

is an important anaerobic gut

commensal of humans that prevents and cures intestinal inflammation. We wished to elucidate

aspects of gut colonization employed by

B. fragilis

. Fluorescence in situ hybridization was

performed on colonic tissue sections from

B. fragilis

and

Escherichia coli

dual-colonized

gnotobiotic mice. Epifluorescence imaging reveals that both

E. coli

and

B. fragilis

are found in the

lumen of the colon, but only

B. fragilis

is found in the mucosal layer. This observation suggests

that physical association with intestinal mucus could be a possible mechanism of gut colonization

B. fragilis

. We investigated this potential interaction using an

in vitro

mucus binding assay and

show here that

B. fragilis

binds to murine colonic mucus. We further demonstrate that

B. fragilis

specifically and quantitatively binds to highly purified mucins (the major constituent in intestinal

mucus) using flow cytometry analysis of fluorescently labeled purified murine and porcine

mucins. These results suggest that interactions between

B. fragilis

and intestinal mucin may play a

critical role during host-bacterial symbiosis.

Keywords

Bacteroides fragilis

; gut commensal; mucin; adhesion; microbiota

Following a sterile birth, the gastrointestinal (GI) tracts of humans and all mammals

coordinately assemble a diverse multitude of microorganisms, collectively known as the

microbiota. It has been acknowledged for decades that many of these microorganisms live

symbiotically with their hosts, performing beneficial functions such as metabolizing

complex carbohydrates and providing essential nutrients [1]. Recent studies have shown that

the microbiota critically augments the development and function of the immune system

(reviewed in [2] and [3]). Although the microbial diversity in the mammalian gut is vast

(with an estimated 500-1000 species of microorganisms present in the human), organisms

belonging to the genus

Bacteroides

represent one of the most abundant microbial taxa in

both mice and humans [4].

Bacteroides fragilis

is a ubiquitous Gram-negative anaerobic

To whom correspondence should be addressed: sarkis@caltech.edu, Division of Biology, California Institute of Technology,1200 E.

California Bl., Mail Code: 156-29, Pasadena, CA 91125. ph: 1-626-395-2356.

Present address: Dept. of Microbiology and Immunology, Fairchild Science Building D300, 299 Campus Drive, Stanford University,

Stanford, CA 94305

Publisher's Disclaimer:

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our

customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of

the resulting proof before it is published in its final citable form. Please note that during the production process errors may be

discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

NIH Public Access

Author Manuscript

Anaerobe

. Author manuscript; available in PMC 2012 August 1.

Published in final edited form as:

Anaerobe

. 2011 August ; 17(4): 137–141. doi:10.1016/j.anaerobe.2011.05.017.

NIH-PA Author Manuscript

bacterium that inhabits the lower GI tract of most mammals [5]. Recent findings have

revealed that this organism possesses the ability to direct the cellular and physical

maturation of the host immune system and to protect its host from experimental colitis [6],

[7], [8]. Therefore, the contributions of the microbiota to human health appear to be

profound.

We wanted to understand how

B. fragilis

colonizes the mammalian gut.

B. fragilis

expresses

at least eight distinct surface capsular polysaccharides (CPS), and previous studies have

shown that CPS expression by the bacterium is required for successful intestinal

colonization [9], [10]. How these molecules mediate the initial interactions with the host,

and whether they are involved in long-term persistence in the gut are currently unknown.

Several mechanisms of gut colonization by symbiotic bacteria have been studied. Some

organisms form biofilms, composed of a polymeric matrix secreted by the bacteria, which

adhere to the epithelial layer. Others interact with components of the mucosal layer

(reviewed in [11]). Mucus is a viscous stratum which separates epithelial cells from the

lumen of the gut and acts as a crucial barrier against infection by pathogens. Various

membrane-bound or secreted glycoproteins called mucins associate with one another to form

the gel-like mucus. Interactions between gut bacteria and mucus have been hypothesized to

be important for the assembly and stability of the microbiota [12]. Accordingly, we sought

to determine whether or not

B. fragilis

binds intestinal mucus and purified mucin.

Initially, we visualized the spatial localization in the colon of 2 different commensal bacteria

to determine potential differences in association with the mucus layer

in vivo.

Wild-type

Bacteroides fragilis

NCTC9343 was grown anaerobically in brain-heart infusion (BHI)

supplemented with hemin (5

g/ml) and vitamin K (0.5

g/ml), and

Escherichia coli

BL21

was grown aerobically in BHI at 37°C. Bacteria were grown to OD

600

of 0.7-0.8 and 1×10

colony forming units (CFUs) were orally inoculated into germ-free Swiss Webster mice by

gavage. Following 1 week of colonization, mice were sacrificed and colon tissue was fixed

in Carnoy's solution and embedded in paraffin wax for sectioning. Fluorescence in situ

hybridization was performed on tissue sections mounted on glass slides using a 6-

carboxyfluorescein (6-FAM)-labeled oligonucleotide probe for

E. coli

(EnterbactB

[AAGCCACGCCTCAAGGGCACAA]) and a Cy3-labeled oligonucleotide probe for

fragilis

(Bfra602 [GAGCCGCAAACTTTCACAA]) (Integrated DNA Technologies, Inc.).

Briefly, slides were deparaffinized, dried, and hybridized with both probes at 5ng/

concentration each for 2 hours at 46°C in hybridization buffer (0.9 M NaCl, 15%

formamide, 20mM Tris-HCl (pH 7.4), and 0.01% sodium dodecyl sulfate (SDS)). Slides

were washed for 15 minutes at 48°C in wash buffer (20mM Tris-HCl (pH 7.4), 318 mM

NaCl, and 0.01% SDS). For visualization of the colon epithelial cell nuclei, the slides were

counterstained with 4

′

-diamidino-2-phenylindole (DAPI). The autofluorescence

background allowed visualization of the tissue structures. The slides were examined with an

Axioplan microscope (Zeiss, Oberkochen, Germany) using a 100× oil immersion objective.

Epifluorescence images of a cross section through the colon of gnotobiotic mice that were

dual-colonized with both

E. coli

and

B. fragilis

reveal that both bacteria are found in the

lumen of the gut in high abundance (Fig. 1). Surprisingly however, only

B. fragilis

is found

in the mucus layer that lies between the lumen and the gut epithelium tissue (Fig. 1). The

spatial segregation of

B. fragilis

and

E. coli

across the colon mucus barrier suggests that

fragilis

may interact with mucus

in vivo

and this may be important for sustained

colonization of commensal

B. fragilis

. Furthermore, these results reveal that not all bacteria

are equally able to penetrate the mucus layer, suggesting dedicated mucus associating

functions for

B. fragilis

To test the hypothesis that

B. fragilis

colonization of the distal gut is mediated by mucus

binding, a standard mucus binding assay was used to determine if live bacteria are able to

Huang et al.

Page 2

Anaerobe

. Author manuscript; available in PMC 2012 August 1.

NIH-PA Author Manuscript

bind a crude, intestinal mucus preparation. Crude mucus was isolated from the colon and

cecum of conventionally-colonized Swiss Webster mice as described in Cohen

et al

[13].

Briefly, colonic and cecal mucus was scraped into HEPES-Hanks' Buffer (pH 7.4 with

Calcium Chloride and Magnesium Chloride). Next, non-soluble material was removed by

centrifuging once at 12,000 × g for 10 minutes at 4°C, and then once at 26,500 × g for 15

minutes at 4°C. The final concentration of the crude mucus solution was determined by the

Bradford assay. The mucus was diluted with HEPES-Hanks' Buffer to 1mg/ml. 0.2 ml of

mucus was added into the wells of a 24-well tissue culture plate and incubated overnight at

4°C. Controls included wells containing 0.2 ml of a 1mg/ml solution of Bovine Serum

Albumin (BSA, which served as a specificity control) or 0.2 ml of HEPES-Hanks' Buffer

(which served as a negative control). The wells were washed with HEPES-Hanks' Buffer to

remove non-immobilized proteins. The plate was UV-sterilized for 10 minutes and was

ready for use in the mucus binding assay. 1×10

CFUs of bacteria were added to

immobilized mucus, or BSA control, and incubated at 37°C for 1 hour. Wells were washed

with HEPES-Hanks' Buffer, treated with 0.05% trypsin for 10 minutes at room temperature

to liberate bacteria. One milliliter of cold BHI was added to quench the trypsin activity.

Samples were serially diluted and plated for CFUs. Fig. 2A shows that

B. fragilis

binds to

crudely purified mucus

in vitro

, as determined by recovered CFUs. The BSA- and buffer-

containing wells illustrate low background binding. A mutant strain of

B. fragilis

(CPM1),

which only expresses one of the eight CPS [9], is able to bind mucus as effectively as wild-

type

B. fragilis

, suggesting that CPS expression does not mediate mucus binding. Therefore,

B. fragilis

specifically binds intestinal mucus via a mechanism that appears not to involve

expression of multiple surface polysaccharides.

Next, a mucus binding competition assay was performed to determine if the interaction

between

B. fragilis

and mucus is saturable. We reasoned that as

B. fragilis

is pre-coated with

higher concentrations of excess mucus, fewer putative receptors would be available to bind

immobilized mucus in the well. Briefly, 1×10

CFUs of

B. fragilis

were incubated with

excess mucus at 37°C for 2 hours under aerobic conditions with shaking. Bacteria were

washed and added to wells of a 24-well tissue culture plate containing immobilized mucus,

BSA, or nothing (prepared as above). After 1 hour, samples were treated with trypsin and

serially diluted, and plated for CFUs. Unexpectedly, pre-incubation with excess mucus

appeared to increase

B. fragilis

binding to mucus with a bi-phasing profile (Fig. 2B).

Binding to immobilized mucus reached a peak when

B. fragilis

was pre-incubated with 0.2

mg/ml of excess mucus. Pre-incubation of bacteria with excess mucus at concentrations

higher than 0.2 mg/ml resulted in a decrease in mucus binding, yet binding was still higher

than without pre-incubation with mucus. Pre-incubation of bacteria with 0.4mg/ml and 1mg/

ml of BSA did not affect binding, once again showing that the

B. fragilis

-mucus interaction

is specific (data not shown). These results suggest that bacteria pre-incubated with mucus

(and not BSA) are increased in their ability to bind immobilized mucus until putative

receptors are saturated at the highest mucus concentrations. Further experiments are required

to determine if dedicated molecules on the bacterial surface mediate mucus binding.

Intestinal mucus is known to contain host molecules in addition to mucin, such as anti-

microbial peptides, immunoglobulin A (IgA) antibodies, and lysozyme [13]. We wished to

determine if mucus binding by

B. fragilis

was specific to mucin. As murine colonic mucin is

not commercially available, we purified mucins from Swiss Webster mice based on the

protocol by Shekels

et al

. [14] with a few modifications. Fig. 3 illustrates a schematic of this

modified protocol and the analysis of mucin purity. We then tested the purified mucin and

BSA for specific binding by

B. fragilis

. Purified mucin and the BSA control were labeled

with Thermo Scientific DyLight Amine-Reactive Fluor 488, and unbound fluorophores were

removed from the sample via dialysis against PBS.

B. fragilis

was pre-incubated with either

unlabeled BSA or PBS and was subsequently incubated with labeled mucin or labeled BSA

Huang et al.

Page 3

Anaerobe

. Author manuscript; available in PMC 2012 August 1.

NIH-PA Author Manuscript

for 30 minutes at room temperature. The bacteria were washed after each incubation to

remove non-adherent material. Percentage of mucin-binding bacteria in each sample was

determined by flow cytometry (FC). When

B. fragilis

was incubated with fluorescently

labeled BSA, no binding was detected (Fig. 4A). However, when

B. fragilis

was incubated

with labeled mucin, a significant number of

B. fragilis

was detected by flow cytometry. Pre-

incubation with BSA did not diminish the percentage of

B. fragilis

adherent to mucin (Fig.

4A). Taken together,

B. fragilis

binds specifically to purified murine colonic mucin and not

to BSA.

B. fragilis

colonizes the intestines of most mammalian species studied to date [5]. In order to

determine if mucin interactions extend beyond the murine host, we examined the ability of

B. fragilis

to bind porcine mucin. Starting with partially purified porcine gastric mucin

purchased from Sigma Aldrich, we purified mucin to homogeneity using the same protocol

as described above. Fig. 4B shows

B. fragilis

binding to fluorescently labeled purified

porcine mucin as significant amount of mucin-binding bacteria were detected by flow

cytometry. Both approaches we used in this study to demonstrate mucus binding resulted in

only a small portion of bacterial binding (

∼

1.6% for the immobilized plate assay and

∼

1.5%

for the soluble mucin binding assay). This is consistent with the known ability of

B. fragilis

to be highly phase variable whereby only a portion of the bacterial population express a

given surface molecule [15]. Fig. 4C shows that pre-incubation with 1.0 mg/ml of unlabeled

mucin was able to compete with the fluorescently-labeled mucin, resulting in a lower

percentage of bacteria binding to the fluorescently labeled mucin. Pre-incubation with BSA

shows no inhibition (Fig. 4C), serving as a specificity control. Our results show that

fragilis

specifically binds porcine mucin in addition to murine mucin.

B. fragilis

has emerged as a model symbiont for the study of host-microbial interactions with

the immune system [3]. The mechanism by which

B. fragilis

maintains long-term

colonization of the mammalian intestine remains unknown. Associations with mucus may

involve bacterial binding, and/or nutrient utilization of mucin for bacterial growth. If

binding to mucus is involved during the colonization process

in vivo

, we predict that

fragilis

would express defined and dedicated receptor(s) with specific affinity for mucin.

Along these lines, the

B. fragilis

genome and other sequenced

Bacteroides

species express

numerous homologs of the SusC/SusD proteins, which are known to bind starch and other

carbohydrates that decorate the mucin glycoproteins [16]. Furthermore, SusC/SusD proteins

B. fragilis

were recently shown to be phase variable [17]. This property is similar to the

phase variability of capsular polysaccharides, whereby only a small fraction of bacteria

express any one of the eight CPS of

B. fragilis

[9]. If mucus binding is also phase variable,

this would explain why only a small percentage of bacteria invade the mucus layer (as

shown in Fig. 1), and why only a small fraction of bacteria bind mucus and mucin

in vitro

(as shown in Figs. 2 and 4). A non-mutually exclusive function for mucus binding may be

the use of host derived sugars as a carbon source. Several studies have shown that

B. fragilis

can degrade mucin and utilize it as a nutrient source for growth [18], [19]. In fact,

B. fragilis

can utilize porcine mucin as a sole source for carbon and nitrogen [20], and structural

analysis of the SusD homolog of

Bacteroides thetaiotaomicron

(also found in

B. fragilis

)

suggests it binds sugars liberated from mucin glycoproteins [21]. Therefore, mucus binding

may serve as a physical mechanism for sustained colonization, as a means to degrade and

import nutrients into the bacterial cell for growth, or both. We have shown here that

fragilis

specifically binds intestinal mucin (although

B. fragilis

may also bind to other

components in the mucus) and associates with the mucus layer

in vivo

. These findings, along

with previous work, suggest that specific interactions between

B. fragilis

and mucus are

relevant for

in vivo

colonization of animals. The identity of dedicated mucin binding

receptor(s), and a molecular mechanism during long-term association of the mammalian gut,

await discovery.

Huang et al.

Page 4

Anaerobe

. Author manuscript; available in PMC 2012 August 1.

NIH-PA Author Manuscript

Acknowledgments

We are grateful to Dr. William Clemons, Jr (Caltech) and Justin Chartron (Caltech) for help with mucin

purification. S.K.M. is a Searle Scholar. Work in the laboratory of the authors is supported by funding from the

National Institutes of Health (DK078938, DK083633), Damon Runyon Cancer Research Foundation and the

Crohn's and Colitis Foundation of America to S.K.M.

References

1. Hooper LV, Gordon JI. Commensal host-bacterial relationships in the gut. Science. 2001;

292:1115–8. [PubMed: 11352068]

2. Macpherson AJ, Harris NL. Interactions between commensal intestinal bacteria and the immune

system. Nat Rev Immunol. 2004; 4:478–85. [PubMed: 15173836]

3. Round JL, Mazmanian SK. The gut microbiota shapes intestinal immune responses during health

and disease. Nat Rev Immunol. 2009; 9:313–23. [PubMed: 19343057]

4. Ley RE, Peterson DA, Gordon JI. Ecological and evolutionary forces shaping microbial diversity in

the human intestine. Cell. 2006; 124:837–48. [PubMed: 16497592]

5. Ley RE, Hamady M, Lozupone C, Turnbaugh PJ, Ramey RR, Bircher JS, et al. Evolution of

mammals and their gut microbes. Science. 2008; 320:1647–51. [PubMed: 18497261]

6. Mazmanian SK, Liu CH, Tzianabos AO, Kasper DL. An immunomodulatory molecule of symbiotic

bacteria directs maturation of the host immune system. Cell. 2005; 122:107–18. [PubMed:

16009137]

7. Mazmanian SK, Round JL, Kasper DL. A microbial symbiosis factor prevents intestinal

inflammatory disease. Nature. 2008; 453:620–5. [PubMed: 18509436]

8. Round JL, Mazmanian SK. Inducible Foxp3+ regulatory T-cell development by a commensal

bacterium of the intestinal microbiota. Proc Natl Acad Sci U S A. 2010; 107:12204–9. [PubMed:

20566854]

9. Liu CH, Lee SM, Vanlare JM, Kasper DL, Mazmanian SK. Regulation of surface architecture by

symbiotic bacteria mediates host colonization. Proc Natl Acad Sci U S A. 2008; 105:3951–6.

[PubMed: 18319345]

10. Coyne MJ, Chatzidaki-Livanis M, Paoletti LC, Comstock LE. Role of glycan synthesis in

colonization of the mammalian gut by the bacterial symbiont

Bacteroides fragilis

. Proc Natl Acad

Sci U S A. 2008; 105:13099–104. [PubMed: 18723678]

11. Macfarlane S, Dillon JF. Microbial biofilms in the human gastrointestinal tract. J Appl Microbiol.

2007; 102:1187–96. [PubMed: 17448154]

12. Sonnenburg JL, Angenent LT, Gordon JI. Getting a grip on things: how do communities of

bacterial symbionts become established in our intestine? Nat Immunol. 2004; 5:569–73. [PubMed:

15164016]

13. Cohen PS, Laux DC. Bacterial adhesion to and penetration of intestinal mucus in vitro. Methods

Enzymol. 1995; 253:309–14. [PubMed: 7476395]

14. Shekels LL, Lyftogt C, Kieliszewski M, Filie JD, Kozak CA, Ho SB. Mouse gastric mucin:

cloning and chromosomal localization. Biochem J. 1995; 311:775–85. [PubMed: 7487932]

15. Kuwahara T, Yamashita A, Hirakawa H, Nakayama H, Toh H, Okada N, et al. Genomic analysis

Bacteroides fragilis

reveals extensive DNA inversions regulating cell surface adaptation. Proc

Natl Acad Sci U S A. 2004; 101:14919–24. [PubMed: 15466707]

16. Xu J, Mahowald MA, Ley RE, Lozupone CA, Hamady M, Martens EC, et al. Evolution of

symbiotic bacteria in the distal human intestine. PLoS Biol. 2007; 5:e156. [PubMed: 17579514]

17. Nakayama-Imaohji H, Hirakawa H, Ichimura M, Wakimoto S, Kuhara S, Hayashi T, et al.

Identification of the site-specific DNA invertase responsible for the phase variation of SusC/SusD

family outer membrane proteins in

Bacteroides fragilis

. J Bacteriol. 2009; 191:6003–11. [PubMed:

19648246]

18. Roberton AM, Stanley RA. In vitro utilization of mucin by

Bacteroides fragilis

. Appl Environ

Microbiol. 1982; 43:325–30. [PubMed: 6174077]

Huang et al.

Page 5

Anaerobe

. Author manuscript; available in PMC 2012 August 1.

NIH-PA Author Manuscript

19. Tsai HH, Sunderland D, Gibson GR, Hart CA, Rhodes JM. A novel mucin sulphatase from human

faeces: its identification, purification and characterization. Clin Sci (Lond). 1992; 82:447–54.

[PubMed: 1315656]

20. Macfarlane GT, Gibson GR. Formation of glycoprotein degrading enzymes by

Bacteroides

fragilis

. FEMS Microbiol Lett. 1991; 61:289–93. [PubMed: 1903753]

21. Koropatkin N, Martens EC, Gordon JI, Smith TJ. Structure of a SusD homologue, BT1043,

involved in mucin O-glycan utilization in a prominent human gut symbiont. Biochemistry. 2009;

48:1532–42. [PubMed: 19191477]

Huang et al.

Page 6

Anaerobe

. Author manuscript; available in PMC 2012 August 1.

NIH-PA Author Manuscript

Fig. 1.

Colon tissue section from

B. fragilis

and

E. coli

dual-colonized Swiss Webster mouse.

Epifluorescence image of bacteria visualized by FISH, and the epithelial cells counterstained

with DAPI (blue) to visualize DNA. Both

E. coli

(green) and

B. fragilis

(red) are found in

the lumen but only

B. fragilis

is found in the mucus layer.

Huang et al.

Page 7

Anaerobe

. Author manuscript; available in PMC 2012 August 1.

NIH-PA Author Manuscript

Fig. 2.

B. fragilis

binds intestinal mucus. (A) Number of

B. fragilis

(in CFUs) recovered after one

hour incubation in wells with an immobilized mucus layer, an immobilized BSA layer, or

buffer only. Of the 1×10

CFUs incubated, 1.6×10

(1.6%) bound to immobilized mucus.

The CPM1 mutant binds mucus similarly to wild-type bacteria. These data are representative

of four independent trials. (B) Number of bacteria recovered from mucus binding assay after

a 2 hour pre-incubation with different concentrations of excess mucus. These data are

representative of three independent trials.

Huang et al.

Page 8

Anaerobe

. Author manuscript; available in PMC 2012 August 1.

NIH-PA Author Manuscript

Fig. 3.

Schematic of the mucin purification protocol. Briefly, crude mucus was scraped from the

colon and cecum of conventionally colonized 8-week-old male Swiss Webster mice into 0.1

M NH

HCO

, 0.5 M NaCl, and a cocktail of protease inhibitors on ice. The sample was then

homogenized and centrifuged at 45,000 × g for 45 minutes at 4°C. Non-soluble material was

removed before centrifuging again at 45,000 × g for another 45 minutes at 4°C. The

supernatant was taken and dialyzed against 10 mM Tris pH 8.0 + 150 mM NaCl for about

24 hours. Next, the sample was sonicated at eight 15-second pulses with intermediate 1

minute cooling on ice on a Brason Sonicator at speed 3 to break up large aggregates and

then centrifuged once more at 45,000 × g for 45 minute. Next HPLC was employed whereby

the supernatant was size fractionated on a XK 26/70 column containing Sephacryl S-400

resin (equilibrated in 10 mM Tris, pH 8.0). The void volume (which contained the large

mucin glycoproteins) was collected and dialyzed against water for about 36 hours and then

lyophilized. The lyophilized glycoproteins were resuspended in a solution containing RNase

A and DNase I and digested for 2 hours at room temperature. After the digestion, the sample

was centrifuged at 27,000 × g for 30 minutes at 4 °C and the supernatant was dialyzed

against

hosphate

uffered

aline (PBS) for 36 hours. Cesium chloride was added to the

dialyzed supernatant to a final concentration of 0.54 g/ml, and then centrifuged at 160,000 ×

g for 72 hours. One milliliter fractions were collected and analyzed with the Pro Q Emerald

Glycoprotein Staining Kit to determine which fractions contained the purified mucins. The

mucin-containing fractions were pooled, dialyzed against water for 24 hours, lyophilized,

and then stored at -20°C. Positive fractions from gel filtration chromatography were

identified by absorbance readings at 280 nm. CsCl fractions and final product were assayed

to contain mucin by glycoprotein staining (data not shown).

Huang et al.

Page 9

Anaerobe

. Author manuscript; available in PMC 2012 August 1.

NIH-PA Author Manuscript

Fig. 4.

B. fragilis

binds soluble murine and porcine mucin. (A) Flow cytometry plots indicating

percentage of

B. fragilis

bound to fluorescently labeled murine colonic mucin. Cells were

either pre-incubated with BSA or not (1°), and secondary incubations were with

fluorescently labeled BSA or mucin (denoted by asterisk). Percentages represent bacteria

bound to fluorescently-labeled mucin relative to total number of bacteria analyzed per

sample. These data are representative of two independent trials. (B) Percentage of

B. fragilis

bound to fluorescently labeled porcine mucin with no pre-incubation. These data are

representative of two independent trials. (C) Percentage of

B. fragilis

bound to fluorescently

labeled porcine gastric mucin following pre-incubation with unlabeled mucin (left) or

Huang et al.

Page 10

Anaerobe

. Author manuscript; available in PMC 2012 August 1.

NIH-PA Author Manuscript

unlabeled BSA (right). Porcine mucin was purchased from a commercial source and purified

as described in Figure 3 from the RNase/DNase digestion step. These data are representative

of two independent trials.

Huang et al.

Page 11

Anaerobe

. Author manuscript; available in PMC 2012 August 1.

NIH-PA Author Manuscript