Inhibition of SARS-CoV-2 growth in the lungs of mice by a peptide-conjugated morpholino oligomer targeting viral RNA

Original Article

Inhibition of SARS-CoV-2 growth in the lungs

of mice by a peptide-conjugated morpholino

oligomer targeting viral RNA

Alexandra Sakai,

Gagandeep Singh,

Mahsa Khoshbakht,

Scott Bittner,

Christiane V. Löhr,

Randy Diaz-Tapia,

Prajakta Warang,

Kris White,

Luke Le Luo,

Blanton Tolbert,

Mario Blanco,

Amy Chow,

Mitchell Guttman,

Cuiping Li,

Yiming Bao,

Joses Ho,

Sebastian Maurer-Stroh,

Arnab Chatterjee,

Sumit Chanda,

Adolfo García-Sastre,

Michael Schotsaert,

John R. Teijaro,

Hong M. Moulton,

and David A. Stein

Scripps Research Institute, La Jolla, CA 92037, USA;

Department of Microbiology, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA;

Global Health

and Emerging Pathogens Institute, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA;

Department of Biomedical Sciences, Carlson College of Veterinary

Medicine, Oregon State University, Corvallis, OR 97331, USA;

Department of Chemistry, Case Western Reserve University, Cleveland, OH 44106, USA;

Division of

Biology, California Institute of Technology, Pasadena, CA 91125, USA;

National Genomics Data Center, China National Center for Bioinformation, Beijing 100101,

China;

University of Chinese Academy of Sciences, Beijing 100049, China;

GISAID @ A

*STAR Bioinformatics Institute, Singapore 138632, Singapore;

Department

of Pathology, Molecular, and Cell-Based Medicine, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA;

Division of Infectious Diseases,

Department of Medicine, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA;

Tisch Cancer Institute, Icahn School of Medicine at Mount Sinai,

New York, NY 10029, USA;

The Icahn Genomics Institute, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA;

Marc and Jennifer Lipschultz

Precision Immunology Institute, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA

Further development of direct-acting antiviral agents against

human SARS-CoV-2 infections remains a public health prior-

ity. Here, we report that an antisense peptide-conjugated mor-

pholino oligomer (PPMO) named 5

END-2, targeting a highly

conserved sequence in the 5

UTR of SARS-CoV-2 genomic

RNA, potently suppressed SARS-CoV-2 growth

in vitro

and

in vivo

. In HeLa-ACE 2 cells, 5

END-2 produced IC

values

of between 40 nM and 1.15

m

M in challenges using six geneti-

cally disparate strains of SARS-CoV-2, including JN.1.

In vivo

using K18-hACE2 mice and the WA-1/2020 virus isolate, two

doses of 5

END-2 at 10 mg/kg, administered intranasally on

the day before and the day after infection, produced approxi-

mately 1.4 log10 virus titer reduction in lung tissue at 3 days

post-infection. Under a similar dosing schedule, intratracheal

administration of 1.0

–

2.0 mg/kg 5

END-2 produced over 3.5

log10 virus growth suppression in mouse lungs. Electropho-

retic mobility shift assays characterized speci

fi

c binding of

END-2 to its complementary target RNA. Furthermore, us-

ing reporter constructs containing SARS-CoV-2 5

UTR leader

sequence, in an in-cell system, we observed that 5

END-2 could

interfere with translation in a sequence-speci

fi

c manner.

The results demonstrate that direct pulmonary delivery of

END-2 PPMO is a promising antiviral strategy against

SARS-CoV-2 infections and warrants further development.

INTRODUCTION

COVID-19 is caused by the severe acute respiratory syndrome coro-

navirus 2 SARS-CoV-2 virus,

and as of Feburary 2024, it has been

the cause of over 7 million human deaths worldwide. As of December

2023, over 1 million new cases and 9,000 deaths were being reported

monthly from the World Health Organization

’

s (WHO

’

s) six regions.

Furthermore, at least two major epidemiologic studies conclude that

mortality caused by COVID-19 has been underestimated.

Despite US Food and Drug Administration (FDA) approval or Emer-

gency Use Authorization of several therapeutics for the treatment of

COVID-19, the need for the development of additional compounds

to address SARS-CoV-2 infections continues to be a public health

priority.

Direct-acting antiviral agents (DAAs) target a physical

component of the virus directly and are typically designed to interfere

with the virus replication cycle. Several DAAs, including nucleotide

(nt) analogs (e.g., remdesivir and molnupiravir), protease inhibitors

(e.g., Paxlovid), and numerous monoclonal antibodies, when admin-

istered soon after diagnosis, can dramatically reduce the hospitaliza-

tion rate of COVID-19 patients. However, drawbacks to current

Received 6 March 2024; accepted 5 September 2024;

https://doi.org/10.1016/j.omtn.2024.102331

These authors contributed equally

Correspondence:

David A. Stein, Department of Biomedical Sciences, Carlson

College of Veterinary Medicine, Oregon State University, Corvallis, OR 97331,

USA.

E-mail:

dave.stein@oregonstate.edu

Correspondence:

Hong M. Moulton, Department of Biomedical Sciences, Carlson

College of Veterinary Medicine, Oregon State University, Corvallis, OR 97331,

USA.

E-mail:

hong.moulton@oregonstate.edu

Molecular Therapy: Nucleic Acids Vol. 35 December 2024

ª

2024 The Author(s).

Published by Elsevier Inc. on behalf of The American Society of Gene and Cell Therapy.

This is an open access article under the CC BY-NC-ND license (

http://creativecommons.org/licenses/by-nc-nd/4.0/

DAAs include, variously, the requirement for intravenous adminis-

tration in a healthcare setting, side effects, interactions with other

medications, cost, and the selection over time of drug-resistant virus

variants.

–

The development of additional DAAs, especially those

that can be administered orally or by inhalation, is needed to improve

medicinal strategies and to decrease global production of the virus

and the generation of SARS-CoV-2 variants. The results observed

to date with current DAAs suggest that the several-day overlap be-

tween the appearance of disease symptoms and the replication of

SARS-CoV-2 in the respiratory tract of humans represents a period

of time in which a pharmaceutical capable of direct interference in

viral replication can be effective at reducing disease severity. Further-

more, combination treatments consisting of two or more DAAs may

reduce the frequency of escape variant generation and improve clin-

ical outcomes.

Over the past few years, a number of sequence-speci

fi

c RNA-targeted

therapeutic compounds have been FDA approved and commercial-

ized, including at least seven single-stranded oligonucleotide-

type agents.

–

Strategies targeting SARS-CoV-2 RNA, including

small interfering RNA siRNA

–

and antisense oligonucleotide

mixmers,

have demonstrated

in vivo

antiviral ef

fi

cacy in mouse

models of SARS-CoV-2 infection. A SARS-CoV-2-speci

fi

c siRNA-

peptide dendrimer formulation was evaluated in a single clinical trial

in Russia in 2021 (this study was registered at ClinicalTrials.gov

[NCT05184127]). The compound was reported as safe and produced

clinical improvement in patients hospitalized with moderate

COVID-19.

However, there have been no further human clinical

trials with this composition or any other compounds designed to

target SARS-CoV-2 RNA in a sequence-speci

fi

c manner.

Phosphorodiamidate morpholino oligomers (PMOs), also known as

morpholinos, are single-stranded nucleic acid analogs containing

the same bases as DNA, but having a non-natural backbone in place

of the sugar-phosphate backbone of nucleic acids.

PMOs feature

high sequence speci

fi

city and biological compatibility and exert their

antisense activity through steric blockade, as their hybridization to

complementary single-stranded RNA does not form a substrate

for RNase H activity.

Four PMOs have been FDA approved

for treatment of Duchenne

’

s muscular dystrophy.

–

improve entry into cells and subsequent intracellular distribution,

PMOs can be conjugated to a cell-penetrating peptide to produce

peptide-conjugated PMOs (PPMOs).

–

PPMOs are water soluble,

nuclease resistant, and non-toxic at effective concentrations across

a range of

in vitro

and

in vivo

applications.

At least three

PPMOs are currently in human clinical trials (

ClinicalTrials.gov

NCT06204809, NCT06079736, and NCT06185764). PPMOs have

been documented to readily enter numerous cell types

in vitro

and

in vivo

, including primary airway epithelial, without toxicity.

–

In studies designed to evaluate antiviral ef

fi

cacy and speci

fi

city,

PPMOs targeting viral sequences have demonstrated a considerable

ability to suppress the growth of an array of RNA and DNA viruses

in cell cultures and animal models (reviewed by Stein, Nan and

Zhang, and Warren et al.

39-41

The SARS-CoV-2 genome comprises an approximately 29.9-kb sin-

gle-stranded RNA of positive polarity featuring a 5

G cap and 3

polyadenylation.

–

The genomic 5

and 3

UTRs are approximately

265 and 228 nt long, respectively.

The antiviral ef

fi

cacy and spec-

fi

city of PPMO targeting the distal region of ancestral SARS-CoV-2

(strain WA-1/2020) 5

UTR RNA have been demonstrated in Vero

cell cultures.

Here, we extend those observations by evaluating

PPMO antiviral ef

fi

cacy

in vitro

, using a human-derived cell line in-

fected with several different strains of SARS-CoV-2, and

in vivo

, using

a mouse model to compare the antiviral activity of PPMO delivered

by two different routes of administration, intranasal (IN) and intra-

tracheal (IT).

In this study, we evaluated sequence conservation across the SARS-

CoV-2 virome in the region of 5

UTR targeted by an antiviral

PPMO,named 5

END-2,andfoundittobehighlyconserved.We report

here that 5

END-2 was potently effective against several virus strains in

cell cultures and was able to suppress virus growth in the lungs of mice,

using moderate dosing. We also observed that IT administration of a

low dose of PPMO suppressed the growth of SARS-CoV-2 in the lungs

of mice more effectively than a higher dose administered IN under

similar conditions. Furthermore, we demonstrate direct evidence of

PPMO hybridization to its RNA target sequence and its ability to inter-

fere with the process of viral RNA translation.

RESULTS

PPMO design

SARS-CoV-2 is a member of the

Coronaviridae

family, within the or-

der Nidovirales. Considerations in the design of the virus-RNA-tar-

geted PMO sequence, constituting the antisense component of the vi-

rus-targeted PPMO in this study, included historical results that

identi

fi

ed the 5

-terminal region of the 5

UTR in the nidoviruses

mouse hepatitis virus, equine arteritis virus, and porcine reproductive

and respiratory syndrome virus as a highly sensitive site for PPMO

intervention.

–

In addition, the 5

-terminal region of the 5

UTR

of the genomes of other non-nidovirus positive-strand RNA viruses

that utilize cap-dependent translation has been a productive antiviral

PPMO target region in numerous studies.

–

PPMO design for

this study was speci

fi

cally informed by a previous study in which

PPMO produced multi-log reductions in the titer of SARS-CoV-2

strain WA-1/2020 in Vero-E6 cell cultures.

In that study, four

PPMO, with two targeting the 5

-terminal region (named 5

END-1

and 5

END-2) and two targeting the transcription regulatory site

leader sequence (TRS-L) region (named TRS-1 and TRS-2) of

SARS-CoV-2 genomic RNA, had high activity, whereas a PPMO tar-

geting the AUG translation start site region of ORF1a/b (AUG-1,

targeting nt 251

–

275) had only moderate antiviral activity. Another

speci

fi

c consideration in the choice of the PPMO target in the

SARS-CoV-2 genome for this study involved reports published dur-

ing the early stages of the pandemic, indicating that the

fi

rst four nt

of the SARS-CoV-2 genome were more variable than nt 5

–

30.

Considering the various studies and reports above, we focused the

PPMO targeting for this study on sequences in the 5

-terminal region

of the 5

UTR of SARS-CoV-2 genome RNA, speci

fi

cally nt 5

–

Molecular Therapy: Nucleic Acids

2 Molecular Therapy: Nucleic Acids Vol. 35 December 2024

(PPMO 5

END-2). This region includes a majority of the nt

that comprise stem-loop 1 (SL1), a secondary-structure feature

comprising nt 7

–

33 (of the SARS-CoV-2 GenBank Reference

Sequence NC_045512.2).

The PPMOs used in this study are

fi

ned in

Table 1

. The 5

END-2 PPMO was designed with the inten-

tion of interfering with events of the virus life cycle which involve the

-terminal region of the genome 5

UTR, including pre-initiation of

the translation of genomic and most subgenomic mRNAs, as well as

regulation of translation by viral protein NSP1.

–

Along with the

END-2 PPMO, we produced a negative control PPMO (NC705)

which contains the same peptide ((RXR)

XB) as is present in the

END-2 PPMO, but conjugated to a nonsense PMO sequence having

little agreement with any RNA virus or human or mouse transcript

sequences, as determined by BLASTn. Thus, NC705 PPMO is de-

signed to serve as a test for antisense speci

fi

city. The peptide compo-

nent of the PPMO used in this study was chosen based on previous

studies demonstrating its ability as a PMO transporter,

–

along

with the typically high aqueous solubility and low toxicity of PPMO

made with this arginine-rich peptide.

PPMO target in the SARS-CoV-2 5

UTR has high sequence

conservation

Another major factor in PPMO design for this study was PMO target-

site sequence conservation across the SARS-CoV-2 virome. We eval-

uated sequence conservation in the 5

-terminal region (nt 1

–

30) of the

UTR across virus strains representing the SARS-CoV-2 viromic

spectrum. We carried out a comprehensive bioinformatic mutational

analysis of the 5

-terminal region of the 5

UTR to de

fi

ne the degree of

complementary sequence agreement between the 5

END-2 PPMO

and its target across the breadth of the SARS-CoV-2 virome. Nearly

8 million high-quality SARS-CoV-2 sequences, collected from

January 2020 through January 2024 and representing an in-depth

sampling of all lineages in the SARS-CoV-2 virome, were analyzed

for mutations in the 5

END-2 PPMO target sequence region. At least

98.8% of all strains analyzed have perfect agreement between the

END-2 PPMO and its target site in the SARS-CoV-2 genome (nt

–

29) (

Figure 1

), with less than 0.3% having more than a single

base mismatch between 5

END-2 and its target (

Table 2

). Interest-

ingly, our analysis revealed that the SARS-CoV-2 Beta lineage

(B.1.351) has overall around 1% less sequence conservation at nt

–

30 in relation to the ancestral Wuhan-Hu-1 lineage, compared to

other SARS-CoV-2 lineages, including numerous lineages that did

not appear until after Beta in the pandemic. Nevertheless, 5

END-2

PPMO has antisense sequence agreement with at least 98% of each

of the 9,095 isolates of Beta SARS-CoV-2 analyzed at each target res-

idue (

Figure 1

Since mid-2022, strains of the Omicron lineage have become the

dominant circulating SARS-CoV-2 worldwide. We therefore also car-

ried out an Omicron-focused sequence conservation analysis on full-

length high-quality sequences available through the Global Initiative

on Sharing All In

fl

uenza Data (GISAID) from an 18-month period

from April 2022 to October 2023. The mutational pro

fi

les in separate

but contiguous 6-month windows appear in

Table S1

. We analyzed

over 330,000 genomic sequences of Omicron SARS-CoV-2 in total

and determined that for this 18-month period, over 97% of the se-

quences exhibit perfect agreement between the 5

END-2 PPMO

and its target site in the SARS-CoV-2 genome, while approximately

2% have a single mispair of disagreement between 5

END-2 PPMO

and its complementary target. Less than 0.2% of the sequences

analyzed have more than 1 base of disagreement between 5

END-2

and its target.

Together, these analyses provide extensive validation of high

sequence conservation at the 5

END-2 PPMO target site across the

SARS-CoV-2 virome, and they suggest that this region of SARS-

CoV-2 genomic sequence is not substantially increasing in variability

over time.

Electrophoretic mobility shift assays confirm that 5

END-2 PMO

and PPMO bind to target RNA specifically and with high affinity

We wished to characterize the sequence-speci

fi

c hybridization

behavior of the PMO antisense portion of 5

END-2 PPMO with its

RNA target (nt 5

–

29 of SARS-CoV-2 genomic RNA) and to validate

that duplexing of 5

END-2 PPMO with its target RNA occurs in a

sequence-speci

fi

c manner, through Watson-Crick complementary

base pairing. Furthermore, we sought to investigate whether the pres-

ence of the P7 peptide in the 5

END-2 PPMO had an effect on direct

binding of the 5

END-2 PMO to its target RNA. We performed elec-

trophoretic mobility shift assays (EMSAs), using the 5

END-2 PMO

or PPMO and an RNA analyte comprising nt 1

–

36 of SARS-CoV-2

RNA (named SL1 RNA). As a control, we also ran identical assays

but replaced the 5

END-2 PMO or PPMO with the NC705 PMO or

PPMO. For these assays, the concentration of SL1 RNA was

fi

xed

at 2

M per sample while the PMO or PPMO was titrated from

0to16

M in serial reactions (

Figure 2

). On the gels running these

reactions, the SL1 RNA (

Figure 2

A) is visualized as the lower band,

whereas SL1 RNA duplexed with PMO or PPMO appears as a discrete

upper band. Because PMO itself has little ionic charge, it does not

appear as a discrete band on the gels. We observed that 5

END-2

PMO or PPMO behaved similarly (

Figures 2

B and 2D), producing

a noticeable shift, as evidenced by the appearance of the higher-mo-

lecular-weight species (the discrete upper band) in a gradual

Table 1. PPMO used in this study

PPMO name

PPMO sequence (5

-3

)

PPMO target location in SARS-CoV-2 genome

END-2

TGTTACCTGGGAAGGTATAAACCTT

nt 5-29

NC705

CCTCTTACCTCAGTTACAATTTATA

N/A

Based on Wuhan-Hu-1, GenBank: NC_045512.

www.moleculartherapy.org

Molecular Therapy: Nucleic Acids Vol. 35 December 2024 3

concentration-dependent manner. The upper band becomes initially

visible when the 5

END2 PMO or PPMO is present at only a 0.1

concentration in relation to its SL1 target RNA (lane 2 of

Figures 2

B and 2D). As the concentration of 5

END-2 PMO or

PPMO increases, a gradual increase in the intensity of the upper

band (duplexed material) and decrease in the intensity of the lower

band (free SL1 RNA) is evident. Nearly complete duplexing is

apparent when 5

END-2 PMO/PPMO was present at 2

the concen-

tration of the target RNA, and apparently complete duplexing when

present at a 4

concentration to that of the target RNA (lane 8 of

Figures 2

B and 2D). The NC705 PMO (

Figure 2

C) did not produce

any speci

fi

c electrophoretic shift. The reactions containing increasing

amounts of NC705 PPMO exhibited increasing intensity of non-

distinct higher-molecular-weight bands (

Figure 2

E), which migrate

well above the SL1 duplexed species. Since PPMO is positively

charged, due mostly to the presence of arginine residues in the P7

peptide, we speculate that these bands represent non-duplexed

PPMO. In addition, a series of non-distinct high-molecular-weight

bands, likely representing unduplexed PPMO, are also apparent in

lane 8 of the 5

END-2 PPMO gel (

Figure 2

D). These results demon-

strate that 5

END-2 PPMO is capable of annealing speci

fi

cally and

avidly to its RNA target sequence and that the presence of the peptide

portion of the 5

END-2 PPMO does not alter fundamental antisense

duplexing behavior.

END-2 PPMO inhibits the growth of several SARS-CoV-2

variants

in vitro

To evaluate antiviral activity, we

fi

rst sought to determine whether

PPMO 5

END-2, which had been identi

fi

ed as potently antiviral

against the ancestral Wuhan-Hu-1-like human SARS-CoV-2

Figure 1. Heatmap of reference allele frequency in the 5

END-2 PPMO target region of different SARS-CoV-2 lineages

The reference allele (GenBank: NC_045512) frequency at nt positions 1–30 of the SARS-CoV-2 genome was calculated from a dataset of complete and high-

quality human-

origin genome sequences, and visually represented in a heatmap. The reference allele sequence for nt 1–30 is shown in the top horizontal row. This term

inal region of the viral

UTR includes the target of the 5

END-2 PPMO, located from nt 5–29. As of January 8, 2024, the WHO has defined 27 variants of concern, variants of interest, and variants

under monitoring. The vertical axis labels are indicative of the lineage names, which appear in order of their chronological appearance during the pa

ndemic, with the

accompanying numbers in parentheses representing the tally of genome sequences that were analyzed for each specific lineage.

Molecular Therapy: Nucleic Acids

4 Molecular Therapy: Nucleic Acids Vol. 35 December 2024

(WA-1/2020) in Vero-E6 cells, also had substantial antiviral activity

against other SARS-CoV-2 strains, including representative variants

of concern, in HeLa-ACE2 cells.

In these antiviral and cytotoxicity

assays, we included a positive control compound, nirmatelvir (Pax-

lovid), known to have potent antiviral activity against coronaviruses

in vitro

To test the level of antiviral activity, each compound was

applied in a 6- or 8-point dose response, using 3-fold serial dilutions

from the highest concentration of 50 or 80

M PPMO or 5

Mnir-

matelvir. The compounds were added for 5 h, after which the drug-

containing medium was removed before an infection period. The

presence of the drug was omitted during the infection period to pre-

clude possible direct extracellular interaction between the drug and

the inoculating viral particles. After infection, the cells were incu-

bated in the absence of the test compound for 24 h before virus

quanti

fi

cation assays. The two PPMOs and the positive control nir-

matelvir were tested against six strains of virus: the ancestral

Wuhan-Hu-1-like USA WA/2020 (

fi

rst isolated in the United States

in January 2020), a strain from the Delta (B.1.617.2) lineage, and

four strains representing disparate sublineages within the Omicron

clade (BA.1, BA.5, XBB1.5, and JN.1). To evaluate the cytotoxicity

of the PPMO, we used an MTT-based assay and a similar experi-

mental format as above, but we omitted virus infection. The results

of both assays are shown in the charts of

Figure S1

,and

Table 3

summarizes the results from these experiments, showing the cyto-

toxic concentration 50% (CC

), the half-maximal inhibitory con-

centration (IC

), and the 90% inhibition concentration (IC

) for

NC PPMO

-2 PPMO

-2 PMO

NC PMO

SARS-CoV-2

nt 1-36,

-2

PMO/PPMO

target sequence

(nt 5-29) in red

Figure 2. 5

END-2 PMO and PPMO duplex specifically and efficiently with target RNA

(A) Schematic diagram of nt 1–36 of SARS-CoV-2 genome. This RNA (SL1) was produced by

in vitro

transcription and served as the analyte for the experiments of (B)–(E). The

secondary structure of the diagram was produced by “RNAStructure” and the residues representing the 5

END-2 PMO or PPMO target site are shown in red. (B–E) EMSA

gels of reactions containing SL1 and PMO/PPMO. A fixed concentration of SL1 RNA (2

M) was used with titrations of the indicated PMO (B and C) or PPMO (D and E) from

0to16

M, as described in detail in

materials and methods

. The reactions were run on native PAGE comprising 8% acylamide. A table indicating the overall lane-by-lane

composition of the reactions is present below the gels. NC, negative control.

Table 2. Bioinformatic analysis of sequence agreement between 5

END-2 PPMO and its target in a wide array of SARS-CoV-2-genomes (January 2020–

January 2024)

No. of SARS-CoV-2 genome

sequences analyzed

% With perfect

agreement between

END-2 and SARS-CoV-2

% With 1 mismatch

between 5

END-2 and

SARS-CoV-2

% With 2 mismatches

between 5

END-2 and

SARS-CoV-2

% With 3 mismatches

between 5

END-2 and

SARS-CoV-2

% With 4 or more mismatches

between 5

END-2 and

SARS-CoV-2

7,950,404

98.31

1.41

0.07

0.02

0.19

www.moleculartherapy.org

Molecular Therapy: Nucleic Acids Vol. 35 December 2024 5

each compound against each virus. It was not possible to calculate

meaningful selectivity index values for the compounds, as the CC

values were almost all in excess of the highest concentration of the

compounds used in this set of experiments. None of the PPMO pro-

duced signi

fi

cant cytotoxicity at any of the concentrations tested.

Likewise, the positive control compound, as assessed by CC

was benign even at its highest concentration. The 5

END-2

PPMO generated IC

values from approximately 0.040

–

1.14

The data indicate that the 5

END-2 PPMO had high antiviral ef

fi

cacy against all the virus strains and that the activity was sequence

speci

fi

c and noncytotoxic. Overall, these results suggest that 5

END-

2 PPMO has the potential to suppress the growth of a spectrum of

SARS-CoV-2 strains. The favorable pro

fi

le of the considerable anti-

viral ef

fi

cacy of 5

END-2 PPMO against a genetic diversity of

SARS-CoV-2 strains, with minimal impact on cell viability in a hu-

man cell line, provided rationale for further evaluation in an

in vivo

setting.

IN administration of 5

END-2 PPMO moderately inhibits SARS-

CoV-2 growth in the lungs of K18-hACE2 mice

Dose regimen determination

In vitro

and

in vivo

dose-dependent toxicity from P7-PMO is generally

a function of the concentration of the P7 peptide component.

In re-

gard to the potential generic toxicity to mice from IN administration of

the structural type of PPMO used in this study (P7-PMO), several pre-

vious studies using P7-PMO and a similar IN dosing regimen to that

used here reported no apparent toxicity to uninfected animals.

–

We limited the number of doses administered to the mice to two,

occurring 1 day before and 1 day after infection. This regimen intro-

duced minimal stress to the mice, as handling and anesthetization

were limited to a total of three events. Furthermore, our dosing

regimen, with PPMO administrations temporally separate from the vi-

rus infection event, precluded direct interactions between inoculation

virus and drug in the airways on the day of virus inoculation.

IN delivery of treatments and viral titer determination

K18-hACE2 (human angiotensin-converting enzyme 2) mice are

transgenic for hACE2 expression in epithelial cells and can grow

SARS-CoV-2 to high titers in the lungs.

To determine the effect

of intranasal dosing of PPMO on SARS-CoV-2 growth, we dosed

each group of

fi

ve mice twice, with 10 mg/kg of PPMO or vehicle so-

lution only (PBS) at 24 h before and 18 h after infection. The treat-

ments were delivered via IN administration, as was the infection inoc-

ulum of 5,000 focus-forming units (ffu) of WA-1/2020 SARS-CoV-2.

Along with the two PPMO tested, and a PBS-only (vehicle-control)

group, we also included a positive control, the small-molecule anti-

viral compound MK-4482 (molnupiravir, an orally bioavailable

nucleoside analog

), which was administered to the mice orally at

a dose of 150 mg/kg, twice per day, starting at 1 day before infection

and continuing through day 2 post-infection. At 3 days post-infec-

tion, all mice were euthanized and lung tissue collected, homogenized,

and subject to viral titer determination by focus-forming assay. We

observed that NC705 PPMO treatment produced virus titer of

approximately 0.2 log10 ffu/g lung tissue below the PBS-treated con-

trol mice. The average titer reduction of 5

END-2 PPMO dosed at

10 mg/kg per dose was

1.4 log10 ffu/g tissue less than PBS-only-

treated mice (

Figure 3

). Notably, the positive control compound

MK448 lowered lung virus titer by approximately 3 log10 ffu/g tissue,

thereby setting an existent standard of high activity in this model.

IT administration of PPMO results in a greater amount of PPMO

translocation to the lungs than IN administration

Results from previous studies using

fl

uorescein-labeled P7-PMO

(Fl-PPMO) administered via IN administration to uninfected mice

suggested a distribution of signal having an overall gradated manner

from upper to lower lung.

In those studies, Fl-PPMO signal was

most intense along the major bronchi, but signal was also detected in

minor bronchial branches and was observed to enter epithelial cells

surrounding alveoli.

We hypothesized that IN administration of PPMO in the SARS-

CoV-2 experiment described above may have resulted in loss of

PPMO material in the upper respiratory tract, thus limiting antiviral

fi

cacy against SARS-CoV-2 in the lungs. To gain insight into the

relative ef

fi

ciency with which IN and IT administration are able to

deliver PPMO to the lungs, we compared the two routes of delivery

with a lissamine-labeled 5

END-2 PPMO (PPMO-liss) in uninfected

K18-hACE2 mice. The experiment had two arms, with one arm uti-

lizing IN and the other arm utilizing IT administration. Each arm had

two groups (

= 5) corresponding to dose levels of 0 and 10 mg/kg of

PPMO-liss. A single dose was administered to the mice in the same

Table 3. Cytotoxicity (CC) and antiviral (IC) values of nirmatrelvir and PPMO

against six strains of SARS-CoV-2 in HeLa-ACE2 cell culture assays

Drug

Virus

MIC

Nirmatrelvir

WA-1/2020

0.11

0.21

Nirmatrelvir

DELTA

0.04

0.17

Nirmatrelvir

BA.1

0.03

0.08

Nirmatrelvir

BA.5

0.05

0.14

Nirmatrelvir

XBB1.5

0.02

0.05

Nirmatrelvir

JN.1

0.06

0.15

NC705

WA-1/2020

>50

NC705

DELTA

>50

NC705

BA.1

>50

NC705

BA.5

>50

NC705

XBB1.5

>50

NC705

JN.1

>50

24.38

>50

END-2

WA-1/2020

>50

0.17

2.23

END-2

DELTA

>50

0.10

3.51

END-2

BA.1

>50

0.34

3.27

END-2

BA.5

>50

0.04

0.18

END-2

XBB1.5

>50

0.39

13.31

END-2

JN.1

>50

1.14

17.27

For methodologic details, see

materials and methods

section.

Molecular Therapy: Nucleic Acids

6 Molecular Therapy: Nucleic Acids Vol. 35 December 2024

manner as described for each delivery method in the antiviral exper-

iments and the lungs collected 24 h later and bisected into upper and

lower sections. Fluorescence of lung lysates was used for comparison

between routes of administration and between upper and lower lung.

Fluorescence was near background levels for the 0 mg/kg PPMO-liss

samples (data not shown). While there was considerable variability

within this experiment and differences between conditions were not

statistically signi

fi

cant, results suggest a trend toward moderately

higher PPMO concentrations in the lung following IT administration

than with IN administration (

Figures S2

A and S2B). Furthermore,

although this experiment did not address PPMO presence in speci

fi

cell types, the results indicate little difference between the amount of

material found in the upper compared to the lower lung for each de-

livery method (

Figures S2

C and S2D), suggesting widespread PPMO

distribution in the lungs with either route of administration.

IT administration of 5

END-2 PPMO potently inhibits virus

growth in the lungs of K18-hACE2 mice infected with WA-1/2020

To promote greater PPMO delivery into the lungs, we chose to

employ IT delivery of PPMOs. To evaluate virus titer in the lungs,

we performed three experiments using IT administration of PPMO

under similar conditions as described above for the evaluation of virus

growth in the lungs after IN administration of PPMO. Our

fi

rst exper-

iment consisted of only three groups, with the mice treated with either

PBS, a positive control (MK4482, described and administered as

above), or 5

END-2 PPMO (

Figure 4

A). A second independent

experiment included the same three groups and two additional

groups, NC705 PPMO at a dose of 10 mg/kg and 5

END-2 PPMO

at 2 mg/kg (

Figure 4

B). Overall, the second experiment was intended

to serve as a bio-repeat of the

fi

rst experiment, yet also include a nega-

tive control PPMO. The third independent experiment was a dose

titration study with 5

END-2 PPMO at 2, 1, 0.5, 0.25, 0.125, and

0 mg/kg. All three experiments were performed under the same con-

ditions and yielded the same central result: that 5

END-2 PPMO

markedly suppressed virus growth in the lungs by over 3 log10

ffu/g of lung tissue. In the

fi

rst two experiments, the level of virus

reduction produced by 5

END-2 PPMO at 10 mg/kg was slightly

greater than that observed with the positive control compound

MK-4482. In the second experiment (

Figure 4

B), NC705 did not

cause a reduction in virus growth, indicating that the antiviral effect

of 5

END-2 was a function of sequence-speci

fi

c binding of the

PMO portion of the PPMO to viral RNA, and that the overall struc-

tural chemistry of P7-PMO was not a factor in the antiviral effect

of 5

END-2 PPMO. In the third experiment, the antiviral effect of

END-2 was shown to be potent and dose responsive, as treatment

with 1, 0.5, 0.25, and 0.125 mg/kg dosing produced approximately

4.2, 3.2, 1.2, and 1.0 log10 mean suppression of virus growth (

Fig-

ure 4

C), respectively. Under the conditions of this study, the mini-

mum dose necessary to produce robust antiviral ef

fi

cacy of at least

3 log10 ffu/g of lung tissue was 0.5 mg/kg. Overall, we observed a mi-

nor amount of experiment-to-experiment variation in the levels of vi-

rus growth inhibition by the various individual treatments.

The moderately low dosing regimen of two treatments of 0.5

–

2.0 mg/kg of 5

END-2 PPMO delivered directly to the lungs via IT

administration generated similar protection to eight doses of

150 mg/kg MK-4482 given orally. It is further noteworthy that while

MK-4482 dosing included two doses on the day of infection, PPMO

dosing did not occur on the same day as virus inoculation. In this

study, we used the measurement of virus titer in the lungs as a pri-

mary indicator of the ability to limit virus replication. In addition,

to investigate the ability of 5

END-2 PPMO to protect from virus-

associated pathogenesis, we measured the ability of the PPMOs to

protect mice from virus-induced weight loss, using the same experi-

mental conditions as the virus-replication evaluations above. The

mice were weighed daily for 10 days. Mice treated with NC-705

PPMO or PBS suffered 20%

–

35% body weight loss by days 5

–

6 and

did not recover, whereas MK-4482 and 5

END-2 PPMO treatments

completely protected the mice from body weight loss (

Figure 4

D).

We note that the NC705 PPMO appeared to provide a minor protec-

tive effect against weight loss for several days, although it was not sig-

fi

cant, and all of the mice in that group were moribund by day 9.

These results demonstrate that IT-delivered 5

END-2 PPMO sup-

pressed virus growth in the lungs and protected against virus-induced

weight loss. Furthermore, the lack of weight loss in mice treated with

END-2 PPMO indicates that the dosing regimen did not cause

PPMO-associated overt toxicity to the mice.

END-2 PPMO is capable of interfering with the process of

translation

Finally, we sought to gain insight into which aspect of the virus repli-

cative cycle the 5

END-2 PPMO was affecting, to exert its considerable

inhibition of SARS-CoV-2 growth. To investigate whether 5

END-2

PPMO could speci

fi

cally interfere with protein expression in a

cellular milieu, we utilized two plasmid constructs, each containing

different

fl

uorescent-reporter coding sequences. In one construct

Figure 3. 5

END-2 PPMO administered IN limits virus growth

K18-hACE2 mice were treated with PBS, 5

END-2 PPMO, and NC705 (negative

control) PPMO as indicated, via IN instillation at 24 h before and 18 h after IN

administration of 5,000 ffu of WA-1/2020. MK-4482 (molnupravir), used as a pos-

itive control compound, was administered orally twice per day from 1 day before

infection until 2 days post-infection. Viral load in the lungs was measured at 3 days

post-infection by focus-forming assay, as described in

materials and methods

Mean

±

SD is shown (

= 5) and was analyzed by one-way ANOVA with Dunnett’s

multiple comparisons (*

< 0.05; ****

< 0.0001).

www.moleculartherapy.org

Molecular Therapy: Nucleic Acids Vol. 35 December 2024 7

(pSARS2-75/mCherry), the 5

-most 75 nt of the SARS-CoV-2 genome

is followed by the mCherry coding sequence. A second construct

(pRNDM-75/GFP) contains 75 nt of nonsense sequence followed by

the GFP coding sequence (

Figure 5

A). HEK293 cells were treated

with PPMO (5

END-2 or NC705) or PBS for 2.5 h and then were

co-transfected with both plasmids. The contents of the cells were har-

vested 24 h later for reporter-speci

fi

fl

uorescence quanti

fi

cation by

fl

ow cytometry. The experiment was conducted twice, with similar re-

sults (

Figures 5

B and 5C). For the viral leader construct, the 5

END-2

PPMO interfered with the process of mCherry expression in a dose-

dependent manner, while the NC705 PPMO generated little if any

inhibitory effect on protein expression. The results from the non-viral

leader/GFP construct, in which neither PPMO affected expression of

the GFP reporter RNA in a signi

fi

cant manner, further validates the

conclusion that 5

END-2 acted in a sequence-speci

fi

c manner in its

inhibitory effect on the translation of viral leader/mCherry RNA.

DISCUSSION

Despite signi

fi

cant advances in the development of drugs to treat in-

fections with SARS-CoV-2, the magnitude and impact of the ongoing

COVID19 public health threat necessitates continued efforts to

develop additional DAAs against current and future virus variants.

The study here provides a proof-of-principle demonstration that

PPMOs, when administered IT, can generate the suppression of

SARS-CoV-2 growth of over 99.9% in the lungs of mice. The level

of antiviral activity by PPMO using IT delivery is comparable or su-

perior to that reported for current drugs having FDA approval for the

treatment of COVID-19 when those current drugs were tested in

similar murine models using IN or oral administration.

–

In vivo

targeting of the 5

-terminal region of SARS-CoV-2 with anti-

sense oligomers delivered IN has been reported in at least two other

studies.

Those two studies demonstrated that antisense oligomers

delivered IN can markedly limit SARS-CoV-2 growth in the lungs of

experimental animals. Furthermore, those studies helped characterize

how the relationship between SL1 RNA and NSP1 protein regulates

the translation of viral and cellular mRNAs in the infected cell. It is

noteworthy (and remarkable) that the antisense oligomers in those

studies, and in the present study, are apparently able to navigate

the consortium of proteins typically associated with the 5

terminal

Figure 4. 5

END-2 PPMO administered via IT injection markedly limits virus growth in the lungs of K18-hACE2 mice and protects from weight loss

(A–C) K18-hACE2 mice were treated with PBS or the indicated PPMO via IT administration at 24 h before and 18 h after IN administration of 5,000 ffu of SARS

-CoV-2 (strain

WA-1/2020). MK-4482 (molnupravir), used as a positive control compound, was administered orally twice per day from 1 day before infection until 2 day

s post-infection. Virus

load in the lungs was measured at 3 days post-infection by focus-forming assay, as described in

materials and methods

, and charted. The experiments represented by the

graphs in (A)–(C) were carried out under the same conditions (see

materials and methods

), but at independent times. The limit of virus detection (LOD) in the focus-forming

assay was 100 ffu/g tissue, as represented by a dotted line.

= 5, except the experiment of (C), which tested 5’END-2 at various concentrations, where each group contained

3 mice. (D) Mice were treated with PBS, MK-4482, or PPMO, as indicated, under the same experimental conditions as described above. Body weights were me

asured daily

for 10 days post-infection and represented as a percentage of the animal weight on the day of infection. By 8 days post-infection, all the animals in the

NC705 had lost greater

than 35% of their original body weight and were considered moribund.

= 5/group. Data shown as mean

±

SD and analyzed by one-way ANOVA with Dunnett’s multiple

comparisons (***

< 0.001; ****

< 0.0001).

Molecular Therapy: Nucleic Acids

8 Molecular Therapy: Nucleic Acids Vol. 35 December 2024