Tissue specific regulation of the chick Sox10E1 enhancer by different Sox family members

Tissue specific regulation of the chick Sox10E1 enhancer by

different Sox family members

Christina Murko

and

Marianne E. Bronner

Division of Biology and Biological Engineering California Institute of Technology Pasadena, CA

91125

Abstract

The transcription factor Sox10 is a key regulator of vertebrate neural crest development and serves

crucial functions in the differentiation of multiple neural crest lineages. In the chick neural crest,

two cis-regulatory elements have been identified that mediate

Sox10

expression: Sox10E2, which

initiates expression in cranial neural crest; Sox10E1 driving expression in vagal and trunk neural

crest. Both also mediate

Sox10

expression in the otic placode. Here, we have dissected and

analyzed the Sox10E1 enhancer element to identify upstream regulatory inputs. Via mutational

analysis, we found two critical Sox sites with differential impact on trunk versus otic Sox10E1

mediated reporter expression. Mutation of a combined SoxD/E motif was sufficient to completely

abolish neural crest but not ear enhancer activity. However, mutation of both the SoxD/E and

another SoxE site eliminated otic Sox10E1 expression. Loss-of-function experiments reveal Sox5

and Sox8 as critical inputs for trunk neural crest enhancer activity, but only Sox8 for its activity in

the ear. Finally, we show by ChIP and co-immunoprecipitation that Sox5 directly binds to the

SoxD/E site, and that it can interact with Sox8, further supporting their combinatorial role in

activation of Sox10E1 in the trunk neural crest. The results reveal important tissue-specific inputs

into

Sox10

expression in the developing embryo.

Keywords

chick; Sox10; neural crest; otic

Introduction

Neural crest cells are multipotent stem-like cells unique to vertebrate embryos. They initially

arise within the dorsal aspect of the neural tube, but subsequently undergo an epithelial to

mesenchymal transition and migrate extensively throughout the embryo. Upon reaching their

final destinations, they differentiate into a wide range of derivatives, including neurons and

glia of the peripheral nervous system, craniofacial cartilage and bone, and pigment cells of

the skin.

corresponding author: mbronner@caltech.edu.

Publisher's Disclaimer:

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our

customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of

the resulting proof before it is published in its final citable form. Please note that during the production process errors may be

discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

HHS Public Access

Author manuscript

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Published in final edited form as:

Dev Biol

. 2017 February 01; 422(1): 47–57. doi:10.1016/j.ydbio.2016.12.004.

Author Manuscript

A multilevel gene regulatory network, integrating environmental cues and transcriptional

inputs, underlies sequential steps in neural crest formation (

Meulemans and Bronner-Fraser,

2004

Sauka-Spengler and Bronner-Fraser, 2008a

Green et al., 2015

). This culminates in

expression of a set of “neural crest specifier genes” like

FoxD3

and

SoxE

genes (

Meulemans

and Bronner-Fraser, 2004

Sauka-Spengler and Bronner-Fraser, 2008b

Simoes-Costa et al.,

2014

Simoes-Costa et al., 2015

) that reflect formation of bona fide neural crest cells. The

combined action of these transcription factors induces downstream effector genes that

regulate migration and subsequent cell fate choice. Despite species-specific differences, the

main components of this regulatory network are highly conserved across vertebrates (

Green

et al., 2015

;

Haldin and LaBonne, 2010

Despite this deep conservation across species, there are important differences between

neural crest subpopulations along the body axis. For example, only cranial but not trunk

neural crest cells contribute to cartilaginous elements of the face (

Le Douarin, 1980

;

Lwigale

et al., 2004

;

Simoes-Costa and Bronner, 2016

). Interestingly, these differences in

developmental potential are mirrored by the existence of different regulatory elements that

control neural crest gene expression at different axial levels. As case in point, despite the

fact that neural crest specifier genes

FoxD3

and

Sox10

are expressed in neural crest cells

along the entire body axis, different cis-regulatory elements mediate their expression in the

head than in the trunk (

Betancur et al., 2010

;

2011

Simoes-Costa et al., 2012

;

Simoes-Costa

and Bronner, 2016

). For example, two cis-regulatory elements, Sox10E2 and Sox10E1,

mediate

Sox10

expression in the head versus the trunk, respectively.

The cranial Sox10E2 enhancer has been well characterized (

Betancur et al., 2010

) and

mediates initial expression in the cranial neural crest at Hamburger Hamilton (HH) stage 9

via direct inputs from Sox9, Ets1, and cMyb (

Betancur et al., 2010

). This same enhancer

also drives expression in the otic placode, requiring the same transcription factor binding

sites but via inputs from paralogous factors, Sox8 and Pea3 in combination with cMyb

(

Betancur et al., 2011

). Another enhancer, Sox10E1, drives

Sox10

expression in migrating

neural crest cells at vagal and trunk levels, as well as the otic placode. However, its

regulatory inputs have not been previously explored.

Here, we examine the mechanisms controlling Sox10E1 activity, in search of upstream

regulators controlling its trunk neural crest as well as otic activity. By generating serial

deletions and mutating potential binding sites, we find that two SoxD/E sites are required for

enhancer activity in both the trunk neural crest and developing ear. While mutation of the

SoxD/E site alone abolishes trunk enhancer activity, additional mutation of a second SoxE

site is needed to eliminate otic expression. Knockdown experiments identified Sox5 and

Sox8 as upstream regulators of Sox10E1. While Sox8 is important for activation in both otic

and trunk neural crest, Sox5 is only involved in trunk neural crest enhancer activation. We

further show that Sox5 and Sox8 can heterodimerize and that Sox5 is specifically recruited

to the identified SoxD/E site in the Sox10E1 enhancer. Taken together, our results suggest

that Sox5 and Sox8 cooperate in regulating Sox10E1 in the trunk neural crest.

Murko and Bronner

Page 2

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

Results

Sox10E1 is active in migrating vagal and trunk neural crest and otic placode

To analyze the spatiotemporal activity of the Sox10E1 enhancer, we electroporated chick

embryos at different developmental time points with a GFP reporter under the control of the

enhancer fragment. As previously reported (

Betancur et al, 2010

), Sox10E1 starts to activate

GFP expression in migrating neural crest at vagal/anterior trunk levels around HH15. GFP

expression is not detected in the posterior trunk until HH18, when segmental migratory

streams of GFP positive cells are visible (Fig. 1A, 1C), reflecting endogenous Sox10

expression at this stage (Fig. 1B–E). Although

Sox10

mRNA and protein are present in

migrating neural crest (Fig. 1B, D), enhancer-driven expression is not detectable in early

delaminating neural crest cells, suggesting the presence of additional, yet unidentified

regulatory elements that initiate Sox10 expression in this region. In addition to vagal/trunk

neural crest cells, Sox10E1 activates GFP in the otic vesicle as it begins to invaginate around

HH12-13 and onward (Fig. 1G). Reporter expression is never observed in cranial neural

crest cells (Fig. 1F–G).

Identification of essential regions within the Sox10E1 enhancer

The previously isolated Sox10E1 fragment (

Betancur et al., 2010

) is 620bp in length (Fig.

2A). To determine essential regions mediating Sox10E1 activity, we performed a series of

deletions and mutations. Initially, we created deletions to sequentially minimize the region in

approximately 100bp steps from each side. We then tested those constructs for their ability

to drive GFP expression

in ovo

(summarized in Fig. 2B). Two fragments lacking 120bp or

234bp on the 5

′

site (Δ1 and Δ2) were still able to activate GFP in migratory trunk neural

crest cells (Fig. 3A; 10/10) as well as the otic placode (Fig. 3B; 10/10). Interestingly, one

other fragment of 260bp length (Δ8), lost activity in migratory neural crest cells (Fig. 3C),

but was still strongly active in the otic vesicle (Fig. 3C–D, 10/10 each). Another fragment

termed Δ9, where the sequence stretch 5

′

of Δ8 was extended until the beginning of Δ2 still

retained strong GFP expression in the trunk (summarized in Fig. 2B). All other deletions

completely lost activity (Fig. 2B).

Mutation of Sox10E1 binding sites to identify potential inputs

We next searched the Sox10E1 sequence for putative transcription factor binding sites using

the Jaspar and Transfac databases. Predicted sites were analyzed for their conservation

across species using the UCSC and ECR genome browsers (Fig. 2A). Notably, most of the

conserved binding sites fall within the remaining sequence present in Sox10E1Δ8, the

fragment retaining otic expression but loosing trunk activity (Fig. 2A–B). We selected nine

sites and mutated them by substituting 6–15 bp of the core binding site with eGFP coding

sequence (Fig. 2C). We chose these sites either because of high sequence conservation or

because the putative transcription factors are well known as regulatory factors implicated in

neural crest development. We mutated two Sox and two FoxD3 binding sites, as well as

individual sites for Myb, Ets and Zic. Furthermore, we mutated a highly conserved site

predicted to bind stem cell factor Arid3A.

Murko and Bronner

Page 3

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

Mutation of one potential SoxD/E binding site (mutant M4) completely abolishes activity in

the migratory trunk neural crest but has no effect on ear expression (Fig. 4A–C, 5/5 each).

All other mutations tested were still able to drive GFP expression in the neural crest

(summarized in Table 1). While mutation of SoxD/E in construct M4 completely abolishes

trunk crest enhancer activity, mutation of another SoxE site present in the Sox10E1 fragment

(mutant M6) has no effect on trunk neural crest expression (Fig. 4D, 5/5). Interestingly, GFP

expression in the otic placode of the M6 mutant seemed weaker compared to expression of

the M4 construct (Fig. 4E–F, 3/5). When we quantified the fluorescence intensity of the

SoxE (M6) and SoxD/E (M4) mutants in the otic vesicle, we indeed observed a 50%

reduction in fluorescence intensity of M6 compared to M4 (Fig. 4J). When both sites are

mutated, both otic and trunk activity are lost (Fig. 4G–I, 5/5 each). As shown in Fig. 2B–C,

both sites fall within the sequence stretch retained in Sox10E1Δ8.

Sox5 and Sox8 are expressed in the neural crest, but only Sox8 is in the otic vesicle

The results of our mutational analysis suggest that SoxD and SoxE proteins may serve as

potential regulators of Sox10E1 activity. A potential candidate for binding to the M4 site is

the SoxD family member, Sox5, previously implicated in cranial neural crest formation in

chick and Xenopus (

Perez-Alcala et al., 2004

Nordin and LaBonne, 2014

). Consistent with

previous reports (

Perez-Alcala et al., 2004

), we observed

Sox5

expression as early as stage

HH7 in the forming cranial neural folds and its expression becomes more pronounced when

neural crest cells arise at stage HH9-10. Though stronger in the neural crest, it is also

expressed in the neural tube but absent from the ectoderm and not expressed in the otic

placode or the otic vesicle (Fig. 5A).

Sox5

is expressed in the migratory neural crest cells at

vagal and trunk levels (Fig. 5A–B) making it a potential candidate as a regulator of Sox10E1

in this population. It also is strongly expressed in the neural crest streams coming from R4

and R6, which surround the otic vesicles (Fig. 5A), with lower expression in the surrounding

mesoderm.

All SoxE family members are expressed during chick neural crest development, with

expression of

Sox8

and

Sox9

both preceding

Sox10

and thus potentially able to induce its

expression.

Sox8

transcripts are present in otic-epibranchial precursor cells at stage HH8-,

and its expression persists throughout the time of otic vesicle formation. Sox8 activates

endogenous Sox10 expression in this region through regulation of the Sox10E2 enhancer

(

Betancur et al., 2011

). However, it continues to be strongly expressed during formation of

the otic placode and the otic vesicle later (Fig. 5C), by which time the Sox10E1 enhancer

becomes activated. As previously shown (

McKeown et al., 2005

Sox8

is also transiently

expressed in early migrating trunk neural crest cells (Fig. 5D), and thus overlaps with

Sox5

at relevant stages of trunk Sox10E1 activation.

Loss of function experiments identify Sox5 and Sox8 as inputs into Sox10E1

To test for a potential regulatory role, we performed loss-of-function experiments with

individual Sox family members using morpholino antisense oligomers. To this end, we

concomitantly electroporated the full length Sox10E1 enhancer construct with individual

morpholinos and analyzed subsequent enhancer mediated reporter expression. Morpholinos

to Sox8, 9 and 10 are well characterized (

Betancur et al., 2010

2011

Barembaum and

Murko and Bronner

Page 4

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

Bronner, 2013

Simoes-Costa and Bronner, 2016

). To verify efficiency of knockdown by the

Sox5 morpholino, we examined its effects on Sox5 protein expression compared with

control morpholino by Western blot analysis. For this purpose, we performed stage HH4

electroporations to completely abolish Sox5 expression. The results confirm that Sox5 MO

indeed causes loss of Sox5 protein in electroporated embryos (Fig. 6A).

Electroporation of a control morpholino does not affect Sox10E1 driven mCherry expression

(0/19) in the trunk (Fig. 6B). In contrast, co-electroporation of a morpholino targeting Sox5

significantly reduces Sox10E1 reporter expression in trunk neural crest (Fig. 6C), with 14

out of 15 embryos showing reduced or no mCherry expression in the presence of the

morpholino. When we quantify the fluorescence intensity, Sox10E1 reporter expression

upon Sox5 knockdown is reduced to an average of 27% of the level measured in control

morpholino experiments (Fig. 6F). Despite the strong effect on enhancer activity,

endogenous Sox10 levels are only mildly affected by Sox5 reduction (Fig. S1A–F, 3/10). To

further dissect which SoxE family members are involved in regulating Sox10E1 activity, we

individually knocked down Sox8, 9 and 10. A striking reduction in trunk reporter expression

is observed upon knockdown of Sox8 (Fig. 6D, 13/15), similar to the effect of Sox5

knockdown. We did not observe any reduction of endogenous Sox8 levels when Sox5 was

depleted (Fig. S1G–H, 0/5). Knockdown of Sox9 does not affect Sox10E1 expression (0/8,

quantified in Fig. 6F). However, the presence of a Sox10 morpholino reduces enhancer

activity in a subset of the embryos (7/16, Fig. 6E), suggesting that once activated, Sox10

itself might participate in regulating its own expression levels. Because we had identified a

Zic binding site in the critical region mediating trunk enhancer activity, we further tested the

effect of knocking down Zic1. Similar to Sox9 knockdown experiments, the Sox10E1

reporter was not affected by the presence of the Zic1 morpholino (quantified in Fig. 6F).

This is in line with the results we obtained with the M3 mutant that is missing a functional

Zic binding site, which also did not show any reduction in reporter expression (10/10, data

not shown).

Knocking down Sox8 also affects otic reporter expression. While Sox10E1 driven

expression is slightly weaker than in control experiments (Fig. 7A–A

′

) when

electroporations are performed at stage HH8 or earlier (Fig. 7B–B

′

), its expression is largely

unaffected when electroporations are carried out at stage HH9 (Fig. 7C–C

′

). A similar effect

was noted when knocking down Sox9 specifically in the ectoderm. Knockdown of Sox9 at

early stages diminished Sox10E1 reporter expression in some cases (5/18, Fig. 7D–D

′

though the percentage of embryos showing this phenotype was higher for Sox8 (10/18).

Only 2 out of 10 embryos electroporated with the Sox10 morpholino exhibit reduced

expression in the otic, suggesting little or no effect. Sox5 morpholino does not affect

activation of the Sox10E1 reporter expression in the otic vesicle at any stage (1/10, Fig. 7E–

′

). These results are in line with our observations that Sox5 is not expressed in the otic

vesicle itself (Fig. 5A) and mutation in the SoxD/E binding site does not affect otic Sox10E1

activity (Fig. 4B–C). Quantification of fluorescence intensities in the ear was not feasible

due to spherical aberration and autofluorescence of the epithelial sphere. Taken together, the

data suggest that Sox8 regulates Sox10E1 expression in the ear, though there might be some

redundancy with other SoxE family members. Furthermore, our results suggest that

Murko and Bronner

Page 5

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

additional elements may be involved in activating Sox10E1 in the otic vesicle, given the

rather mild effects of our knockdown experiments.

Co-immunoprecipitation suggests an interaction between Sox5 and Sox8

To test for a potential interaction between Sox5 and Sox8, we performed

immunoprecipitation experiments. Because antibodies that are specific to avian Sox8 are not

available, we electroporated chick embryos with a construct expressing a FLAG tagged

version of chicken Sox8. After immunoprecipitation with an antibody to Sox5 or FLAG, we

tested for interaction of Sox8 and Sox5 using either an anti-FLAG or anti Sox5 antibody. In

both cases, we were able to pull down the opposite protein from lysates of embryos

electroporated at stage HH11 (Fig. 6G), indicating that Sox5 and Sox8 can interact with

each other.

Direct binding of Sox5 to the SoxD/E site

The results of our mutation and knockdown studies indicate that the identified SoxD/E

binding site is critical for Sox10E1 enhancer activity in the trunk, potentially involving

direct binding of Sox5 and Sox8 to this region. In order to test this hypothesis we performed

chromatin immunoprecipitation (ChIP) experiments on dissected trunk neural tubes of wild

type chick embryos. Using a ChIP grade antibody to Sox5, we found that Sox5 directly

bound to the Sox10E1 enhancer (Fig. 6H). Interestingly, Sox5 levels are highest at the M4

site alone, and less pronounced across the M4 and M6 sites together. Furthermore, only low

levels of Sox5 are found at the 5

′

region of the Sox10E1 enhancer, outside of the M4

binding site. Taken together, these results suggest that Sox5 is specifically recruited to the

M4 binding site, and this is responsible for activating Sox10E1 in the trunk neural crest.

Discussion

Sry-related high mobility (HMG)-box Sox transcription factors serve widespread functions

during development and are found throughout the animal kingdom. This large family is

comprised of subgroups A-H, which all possess a highly homologous HMG-type DNA

binding domain but share little overall homology outside this region (

Kamachi and Kondoh,

2013

Bowles et al., 2000

). Subgroup SoxE, comprised of Sox8, 9 and 10, is associated with

neural crest cell identity in all vertebrate species examined. In chick embryos, expression of

Sox8

and

Sox9

precedes

Sox10

, which is first evident in delaminating/early migrating neural

crest cells along the entire extent of the body axis and is a critical upstream regulator of

multiple neural crest lineages (

Green et al., 2015

). Later,

Sox10

expression is maintained in

neuronal, glial and melanocytic lineages. Furthermore, it has recently been shown that

Sox10 alone is sufficient to reprogram fibroblasts to a neural crest fate, highlighting the

importance of this factor during neural crest specification (

Kim et al., 2014

Sox5

is the only SoxD member expressed in neural crest cells. In the chick,

Sox5

expressed early on in premigratory neural crest in the head region. Sox5 over-expression

promotes neural crest formation and increases expression of

FoxD3

and

Sox10

(

Perez-

Alcala et al, 2004

). It seems to do so by directly activating expression of RhoB in transfected

cells, which in turn induces

Sox10

expression. Here we show that Sox5 is recruited to

Murko and Bronner

Page 6

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

binding sites in the Sox10E1 enhancer, also demonstrating a direct regulatory interaction

between Sox5 and Sox10. In the trunk, however, this interaction serves more to maintain

rather than induce initial endogenous

Sox10

expression. Consistent with this, we observed a

rather modest decrease in endogenous

Sox10

levels upon Sox5 knockdown. In most cases,

Sox10 still continues to be robustly expressed whereas enhancer expression in dramatically

reduced. However, endogenous Sox10 expression is already observed before Sox10E1

activation (Figure 1), suggesting that other elements, not explored in this study, initiate trunk

Sox10 expression. We hypothesize that once Sox10 is activated, its expression is driven by

several regulatory elements, including but not exclusive to Sox10E1, that cooperate in fine-

tuning and subsequent lineage specific diversification among subpopulations.

In addition to the neural crest, SoxE and SoxD family members are expressed in the

developing ear. Most components of the ear are derived from the otic placode, a region of

thickened ectoderm that forms adjacent to the hindbrain and subsequently invaginates to

form the otic vesicle. Via complex morphogenetic rearrangements and patterning events, this

vesicle is transformed into the entire inner ear (reviewed in

Chen and Streit, 2013

To gain insight into the regulatory interactions important for neural crest and ear

development, we have dissected the cis-regulatory inputs necessary for expression mediated

by the Sox10E1 enhancer element. Similar to the cranial Sox10E2 enhancer, the vagal/trunk

Sox10E1 enhancers drives expression in both the neural crest and otic placode. Notably, the

combined expression pattern driven by Sox10E1 and E2 largely resembles most of that of

endogenous

Sox10

expression. The exceptions are that neither of these elements is active in

delaminating trunk neural crest cells, despite the fact that

Sox10

transcripts are already

present there. Although some of these differences may be due to time required for folding

the GFP reporter protein, this cannot account for the large temporal delay in expression

mediated by Sox10E1 in migrating trunk neural crest cells. Thus, this suggests that there

may be additional regulatory elements that control early endogenous

Sox10

expression. In

particular, endogenous

Sox10

must be activated in delaminating trunk neural crest cells

before Sox10E1 becomes active and maintains

Sox10

expression during migration.

Notably, multiple regulatory elements with overlapping spatiotemporal activities have been

identified for mouse Sox10, with one of them sharing sequence similarity to the chicken

Sox10E1 element (

Werner et al., 2007

). Interestingly, those enhancer elements further bear

identical transcription factor binding sites, suggesting the same regulators are involved in

controlling their activity (

Wahlbuhl et al., 2012

). Thus,

Sox10

expression in a particular

tissue may reflect the combined activity of several regulatory elements rather than a single

element contributing a highly specific spatial or temporal aspect to the overall activity. This

may represent a valuable fail-safe mechanism that accounts for the high levels and

robustness of

Sox10

expression during embryonic development.

In the chick, Sox10E1 and Sox10E2 are both active at certain stages during otic

development and also share common transcription factor binding sites. Hence, the robust

expression in the developing ear and the mild effects of our knockdowns in this area might

reflect redundant regulatory activity of those elements. Furthermore, a third enhancer termed

Murko and Bronner

Page 7

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

L8 has been described that shows similar but weaker activity to Sox10E1 in the ear

(

Betancur et al., 2011

By deletion and mutational analysis, we identified two critical Sox binding sites important

for Sox10E1 mediated activity in both tissues. While one of these (M4) is putatively bound

by SoxD and/or SoxE proteins, the other one (M6) is thought to be recognized by SoxE

proteins only. Interestingly, mutation of the M4 motif alone abolishes enhancer activity in

the trunk crest while leaving otic expression intact. On the other hand, mutation of the M6

motif reduces otic expression, while having no effect on trunk crest expression. Combined

mutation of both elements eliminates activity completely, demonstrating their importance in

both tissues. The tissue specific differences are likely due to tissue specific recruitment of

binding partners, e.g. different Sox family members. We show that Sox5 is indeed recruited

to the M4 site in migrating trunk neural crest cells, where it is abundantly present. In

contrast, Sox5 is not expressed in otic placode cells. Accordingly, the activity of the

Sox10E1 enhancer is significantly reduced in the presence of a Sox5 morpholino in the

trunk, but not in the ear. During otic development, other SoxD family members (e.g. Sox13)

could utilize this site to activate Sox10E1. Alternatively, a SoxE family member (e.g. Sox8)

might be recruited to this site instead. In any case, binding to this site is not crucial for

enhancer function in the otic placode. Instead, the other Sox site identified in this study (M6)

seems to be most critical for otic expression, as mutating this site reduces the intensity of the

enhancer driven expression. However, mutations in both M4 and M6 result in complete loss

of activity, suggesting that both sites are necessary for full functionality.

It is interesting to note that fragment Sox10E1Δ8 looses trunk neural crest activity despite

containing both Sox sites. One possibility is that additional critical binding sites are present

outside of Sox10E1Δ8. Another possible explanation for this discrepancy could lie in the

DNA binding nature of Sox proteins. Besides their transactivation activity, Sox proteins have

been hypothesized to function as architectural proteins that are involved in three-

dimensional shaping of promoters and associated DNA binding proteins (

Chew and Gallo,

2009

). In particular, group D members are thought to act in this manner, as they are missing

transactivation domains. As the M4 site lies very close to the 5

′

end of the Sox10E1Δ8

fragment, those structural features could be impaired even when Sox5 binding is still

possible.

Loss of function of Sox8 reduces expression mediated by the Sox10E1 enhancer in trunk

neural crest, similar to a knockdown of Sox5. Furthermore, our immunoprecipitation

experiments demonstrated that Sox5 and Sox8 can physically interact. This is consistent

with a scenario in which Sox5 and 8 cooperatively bind to the M4 motif to activate Sox10E1

in trunk neural crest. Such an interaction between SoxD and SoxE protein family members

has been described during chondrogenesis. In mice, Sox5, Sox6 and Sox9 cooperate in

activation of Col2A1 transcription. All three proteins bind the same 48bp enhancer element

within the gene and also cooperatively can activate transcription in non-chondrogenic cells

(

Lefebvre et al., 1998

). Experiments in human chondrogenic cells have further shown that

Sox8 can replace Sox9 in activating Col2A1 in combination with Sox5 and Sox6 (

Herlofsen

et al., 2014

), though at reduced efficiency. These studies, however, did not address if this

involves a direct interaction between Sox5/6 and Sox8/9. A more recent study addressing the

Murko and Bronner

Page 8

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

potential of SoxE proteins to interact with other Sox family members suggests that they

indeed are capable of heterodimerization, although homodimerization is favored (

Huang et

al., 2015

). Consistent with these studies, we show that Sox5 and Sox8 are able to bind to

each other

in vitro

. The fact that Sox5 is bound to the M4 site, together with the fact that

knockdowns of either Sox5 or Sox8 show a similar penetrance of phenotype, further

supports the idea that both factors are required cooperatively to activate Sox10E1 in the

trunk. As Sox5 lacks a transactivation domain, it must recruit other transcription factors that

induce Sox10E1 activity. It remains to be elucidated if Sox5 and Sox8 bind the SoxD/E site

individually, or if Sox8 is indirectly recruited to the site via Sox5. We did not detect any

reduction in Sox8 expression after Sox5 knockdown, suggesting that Sox5 does not regulate

Sox8 expression (Fig. S1G–H).

Of all factors tested, only Sox8 knockdown reduced Sox10E1 reporter expression in the otic

vesicle. The effect was, however, stage sensitive and only present in embryos electroporated

at stage HH8 but not at stage HH9. One possible explanation is that this effect is indirect via

loss of Sox8 affecting early expression of Sox10 via a different enhancer. Our previous

studies have shown that Sox10E2 driven expression in the otic placode is activated by Sox8,

together with Pea3 and cMyb beginning around stage HH9+. Knockdown of Sox8 alone

strongly reduces onset of endogenous Sox10 expression in the ear (

Betancur et al., 2011

Once Sox10 is activated, it may regulate its own expression via an autoregulatory feedback

loop, similar to what has been shown to occur in the context of neural crest

Sox10

expression in mice (

Wahlbuhl et al., 2012

In summary, we have identified two critical Sox binding sites in the chicken Sox10E1

enhancer, which differentially control activity in the trunk neural crest and the otic vesicle.

Furthermore, Sox5 binds this enhancer in trunk neural crest and can heterodimerize with

Sox8, both of which are critical regulators of Sox10E1 enhancer activity in the trunk neural

crest. While Sox5 is restricted to the neural crest, Sox8 also seems to be involved in

regulation of otic Sox10E1 activity. However, Sox10E1 in the otic vesicle is likely to utilize

additional yet to be identified inputs. Similar to what was observed for the Sox10E2

enhancer, our study shows that the same Sox10 enhancer can be activated by different inputs

in different tissues. Thus, tissue specific expression occurs via the combined availability of

open regulatory regions within the genome together with the composition of regulatory

factors present in particular tissues.

Material and Methods

Embryos

Fertilized chicken eggs were obtained from commercial sources and incubated at 37°C until

embryos reached the desired developmental stages. Electroporated and wild type embryos

were collected in Ringer’s and staged according to the criteria of Hamburger and Hamilton

(

Hamburger and Hamilton, 1992

)

Murko and Bronner

Page 9

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

Electroporation of chick embryos

Embryos were electroporated as previously described (

Sauka-Spengler and Barembaum,

2008

). DNA was injected at 2. DNA concentration. When coelectroporating morpholinos,

1mM final concentration was used in all experiments, except stated otherwise. Stage HH4

embryos were explanted on filter paper and injected underneath the blastoderm.

Electroporation was carried out in a modified electroporation chamber and 5pulses of 5.2V

were applied for 50ms. Stage HH11 embryos were injected

in ovo

into the trunk neural tube

lumen. Platinum wire electrodes were placed on either side of the embryo and 3 pulses of

20V, 30ms, were applied to deliver the DNA into the cells. To target the otic vesicle, DNA

was placed above the embryo at future midbrain levels in stage HH8-9 embryos. Electrodes

were placed with the anode underneath the embryo and the cathode above the vitelline

membrane and charges were delivered in 3 pulses of 9V, 30ms. Eggs were sealed and

reincubated until the desired developmental stage for further processing.

Morpholino experiments

Knockdown experiments were performed with translation-blocking morpholino antisense

nucleotides (Gene Tools). All morpholinos used were FITC tagged at the 3

′

end and used at

1mM final concentration. The sequences were as follows: Control: 5

′

??-

ATGGCCTCGGAGCTGGAGAGCCTCA-3

′

; Sox8: 5

′

CTCCTCGGTCATGTTGAGCATTTGG-3

′

; Sox9: 5

′

GGGTCTAGGAGATTCATGCGAGAAA-3

′

(described in

Betancur et al., 2010

2011

);

Sox10, 5

′

-CATGGTGACTTCCTTCTTCTCAATT- 3

′

(described in

Barembaum and

Bronner, 2013

), Sox5: 5

′

-CTTGGAAGACATCCTGGAAGGAACA-3

′

; Zic1, 5

′

TGCGGTCCAGCATCCAGAAGCATCT-3

′

(described in

Simoes-Costa et al., 2012

Comparative genomic and mutational analysis

Full length and deletion fragments of the Sox10E1 enhancer fragments was amplified from

genomic chicken DNA using the Expand High Fidelity PCR System (Roche). The following

primers were used: S10E1_S: GGAAGAGAGAAAGACCATGGTG; S10E1_S2:

CATTCTCCAGTGGAAGGGGAC; S10E1_S3: CAGCATCCTTCCCTATCCCT;

S10E1_S4: ATGGCGGACGCCAAAACG; S10E1_S5: GAGAAGGCTGAAGGCCACAG;

S10E1_AS: AGTTGAATGGGTCCCTGG; S10E1_AS2: TTTGGCGTCCGCCATGGA;

S10E1_AS3: TCCCCAGCCTTGCATCTGTAT; S10E1_AS4:

CTTGGATGAGAGGAGGCGTC; Potential transcription factor binding sites were identified

through the JASPAR (

http://jaspar.genereg.net/

) and TRANSFAC (

http://www.gene-

regulation.com/

) databases. Using the USCS genome browser, predicted sites were screened

for conservation across species. Selected sites were mutated by Fusion PCR (

Szewczyk et

al., 2006

) using the following primers (mutated nucleotides are underlined and in bold):

cMyb (M1): Fwd 5

′

-GTACGTACCCTTC

CTACAACAGC

CAAACAAAG-3

′

; Rev 5

′

CTGCTTTCTTTGTTTG

GCTGTTGTAG

GAAGGGTAC-3

′

; FoxD3 (M2): Fwd 5

′

CTCACACAGC

CAGGTGGGCTCCATAT-3

′

; Rev 5

′

GCTGTGTGAG

TTTGAAGAACTGGAGAAGGG-3

′

; Zic (M3): Fwd 5

′

CTACAACAGCCTACA

TGGCCCAGCATC-3

′

; Rev 5

′

TGTAGGCTGTTGTAG

CGAGAGGATTGC-3

′

; SoxD/E (M4): Fwd 5

′

Murko and Bronner

Page 10

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

CATCCTACAC

AGCCATTTAAAAAAAAAGGAGG-3

′

; Rev 5

′

GTGTAGGTAG

CTGCCCGCCTCC-3

′

; FoxD3 (M5): Fwd 5

′

CTT

CTCACACAGC

GACAAGAAAACGACCCCC-3

′

; Rev 5

′

TGTCC

GCTGTGTGAG

TTCCTCCTTTTTTTTTAAATGGCTT-3

′

; SoxE (M6): Fwd 5

′

TGCTA

CTACCTACAC

CACCATTTCAGGGCTGAA-3

′

; Rev 5

′

AATGGTG

GTGTAGGTA

CAATCGTTTTGGCGTCC-3

′

; Arid3A (M7): Fwd 5

′

TGCAC

GCCGGG

GGATTCCACAGAGGGC-3

′

; Rev 5

′

GTGGAATCC

CCCGGC

CACGTTGGTGTGGTGAAA-3

′

; Oct1 (M8): Fwd 5

′

CTCCCGGTT

CCTTTTCTTGGTAAGGATGG-3

′

; Rev 5

′

AACCGGGAG

AGCACTGTGGCCTT-3

′

; Elk/Ets (M9): Fwd 5

′

CTCCAGGAGC

CTTGTGTTCCTTGGGGTCAAC-3

′

; Rev 5

′

CTCCAGGAGC

CTTGTGTTCCTTGGGGTCAAC-3

′

; Amplified fragments were purified

using the Wizard Gel and PCR extraction kit (Promega) and cloned into Asp780I/XhoI

digested pTK GFP reporter vector (

Uchikawa et al., 2003

). For coelectroporation

experiments, full length S10E1 was also subcloned into pTK mCherry vector. Deleted/

mutated S10E1 sequences (in GFP) were coelectroporated with full length Sox10E1 (in

mCherry) to control for electroporation efficiency.

Fluorescence Quantification

To quantify fluorescence intensity in electroporated embryos, we used ImageJ to measure

the integrated density in the region of interest. To correct for different exposure levels

between channels and individual embryos, we also calculated the integrated density from the

mean of 3 background areas. The following formula was used to estimate the corrected total

cell fluorescence (CTCF): Integrated density- (Area of selection x mean fluorescence of

background readings). To adjust for variations in electroporation efficiency, fluorescence of

WT Sox10E1 mCherry signals was normalized to morpholino FITC intensity. For mutated

Sox10E1 constructs, GFP signal intensity of mutants was normalized to fluorescence

intensity of WT Sox10E1 Cherry signal. At least 3 embryos were measured for every

experiment. Statistical significance was estimated using unpaired t-test.

Generation of FLAG tagged Sox8

Chicken Sox8 was PCR amplified from cDNA using Phusion High Fidelity Polymerase

system (New England Biolabs). The FLAG epitope was added to the 3

′

end of the coding

sequence and the sequence was ligated into XhoI/NheI digested pCI-H2B-GFP vector and

confirmed by sequencing. The following primers were used: Fwd: 5

′

ATGCTCAACATGACCGAGGA-3

′

, FLAG_Rev: 5

′

TTACTTGTCATCGTCGTCCTTGTAGTCAGGCCTCGTCAGGGTTGT-3

′

;

Probe preparation and In situ hybridization

RNA

in situ

hybridization on whole mount chicken embryos was performed as described

(

Henrique et al., 1995

) with slight modifications of the post hybridization washes.

Dioxigenin labeled antisense probes were generated by

in vitro

transcription from linearized

templates using Promega RNA polymerases. Probes used were: Sox10 (

Betancur et al,

2010

), Sox8 (

Betancur et al, 2011

), Sox5. The template for the Sox5 probe was generated by

Murko and Bronner

Page 11

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

PCR amplification from the chicken EST clone ChEST277j14 using the following primers:

Fwd: 5

′

-ATGCTCACTGACCCTGATTTAC-3

′

; Rev: 5

′

TGGCCGAAGGACTAGCTAAT-3

′

. Bound probes were detected using an Anti-Dig

antibody conjugated with alkaline Phospatase and NBT/BCIP as the color substrate.

Immunohistochemistry

Embryos were fixed 20 minutes with 4%PFA and washed with TBS containing 0.3%Triton,

1% DMSO. Unspecific binding was blocked with donkey serum and primary antibody

incubation was carried out overnight at 4°C. The antibody used was anti human Sox10

(R&D systems AF2864). Signals were visualized with an Alexa 594 conjugated anti goat

antibody (ThermoFisher).

Immunoprecipitation of protein complexes

Trunk neural tubes of electroporated embryos were dissected in ice cold PBS and

homogenized in IP lysis buffer (50mM Tris pH 7.4, 150mM NaCl, 1% NP40). After pre

clearing with unconjugated beads, lysates were distributed to antibody coated G-agarose

beads (Sigma Aldrich) and incubated at RT for 2–3 hours. Samples were washed 6 times

with IP lysis buffer before precipitated proteins were eluted from beads and subjected to

SDS page. Ten microgram of the following antibodies were used for immunoprecipitation

reactions: anti Sox5 (Abcam ab94396, rabbit, ChIP grade), anti rabbit control IgG (Abcam

ab46548, ChIP grade), anti FLAG M2 (Sigma-Aldrich, F1804, mouse IgG1), anti mouse

IgG1 (Santa Cruz, sc-3877).

Chromatin Immunoprecipitation (ChIP)

Trunk neural tubes of stage HH14-16 embryos were dissected in ice cold PBS and

homogenized in isotonic buffer (10mM Tris pH 7.5, 3mM CaCl

, 0.25M Sucrose, 0.5%

Triton, 1mM DTT, supplemented with Protease inhibitor cocktail, PMSF and Sodium

butyrate). Chromatin was subsequently cross-linked by addition of formaldehyde to a final

concentration of 1%. Cross-linking was stopped by addition of 125mM glycine. The

chromatin isolation procedure was performed as previously described (

Hauser et al., 2002

For ChIP, equal amounts of sonicated chromatin were diluted 10-fold and precipitated

overnight with the following antibodies: anti Sox5 (Abcam ab94396, rabbit, ChIP grade),

anti rabbit control IgG (Abcam ab46548, ChIP grade). Chromatin–antibody complexes were

isolated with protein A magnetic beads (Dynabeads, Invitrogen). Precipitated DNA was

analyzed by real time PCR using SYBR Green (Bio-Rad) on an ABI7000 qPCR machine.

Diluted Inputs were used as Standards.

The following primers were used: 10E1_M4_S1 5

′

-CGCTGGTAACAGAGGGGTTA-3

′

;

10E1_M4_AS1 5

′

-GGGGTCGTTTTCTTGTCCTT-3

′

; 10E1_M4_S2 5

′

GCATCCTTCCCTATCCCTTT-3

′

; 10E1_M4_AS2 5

′

-AAATGGTGCCTTTGTGCAAT-3

′

;

10E1_M4_S3 5

′

-TGGTGTGGGTGAACAGAAGA-3

′

; 10E1_M4_AS3 5

′

TTCTACTTGTGGGGGCACTC-3

′

; 10E1_M4_S4 5

′

CAGGGAACAAAGAAGCCATT-3

′

; 10E1_M4_AS4 5

′

AATCACGTTGGTGTGGTGAA-3

′

; Control_S 5

′

-GGTTGGATTTCCAGTCTCCA-3

′

;

Control_AS 5

′

-TGTTTTGCTGGACAATCTGC -3

′

Murko and Bronner

Page 12

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

Western Blotting

Protein lysates were separated by SDS PAGE and subsequently transferred onto

nitrocellulose membrane. After blocking, membranes were incubated with the primary

antibody overnight, followed by washes in PBST and incubation with HRP conjugated

secondary antibodies (KPL). Signals were visualized using Amersham prime western

blotting detection reagent (GE Healthcare). The following primary antibodies were used:

Anti Sox5 (Abcam ab94396 rabbit), Anti Tubulin (Sigma-Aldrich T9026, mouse IgG), Anti

FLAG M2 (Sigma-Aldrich F1804, mouse IgG1).

Imaging and Figure Preparation

Whole mount embryos and sections were imaged on a Zeiss fluorescent Axioimager D2

research microscope equipped with an Apotome2 and dual Axiocam 506 cameras. Pictures

were taken with Zen2pro Software. A Zeiss axioskop2 microscope equipped with Axio

Vision software was used to image

in situ

stained embryos. Images were processed using

Adobe Photoshop CC15 and figures were prepared in Adobe Illustrator CC15.

Supplementary Material

Refer to Web version on PubMed Central for supplementary material.

Acknowledgments

We thank M. Barembaum and M. Simões-Costa for plasmids and morpholinos. This work was supported by grants

DE024157 and HD037105 to MEB and a postdoctoral fellowship from the Curci foundation and an Erwin

Schrödinger fellowship from the Austrian science fund FWF (J3538-B19) to CM. The authors declare no

competing financial interests.

References

Barembaum M, Bronner ME. Identification and dissection of a key enhancer mediating cranial neural

crest specific expression of transcription factor, Ets-1. Dev Biol. 2013; (382):567–75. DOI: 10.1016/

j.ydbio.2013.08.009 [PubMed: 23969311]

Betancur P, Bronner-Fraser M, Sauka-Spengler T. Genomic code for Sox10 activation reveals a key

regulatory enhancer for cranial neural crest. Proc Natl Acad Sci U S A. 2010; (107):3570–5. DOI:

10.1073/pnas.0906596107 [PubMed: 20139305]

Betancur P, Sauka-Spengler T, Bronner M. A Sox10 enhancer element common to the otic placode and

neural crest is activated by tissue-specific paralogs. Development. 2011; (138):3689–98. DOI:

10.1242/dev.057836 [PubMed: 21775416]

Bowles J, Schepers G, Koopman P. Phylogeny of the SOX family of developmental transcription

factors based on sequence and structural indicators. Dev Biol. 2000; (227):239–55. DOI: 10.1006/

dbio.2000.9883

Chen J, Streit A. Induction of the inner ear: stepwise specification of otic fate from multipotent

progenitors. Hear Res. 2013; (297):3–12. DOI: 10.1016/j.heares.2012.11.018

Chew LJ, Gallo V. The Yin and Yang of Sox proteins: Activation and repression in development and

disease. J Neurosci Res. 2009; (87):3277–87. DOI: 10.1002/jnr.22128 [PubMed: 19437544]

Green SA, Simoes-Costa M, Bronner ME. Evolution of vertebrates as viewed from the crest. Nature.

2015; (520):474–82. DOI: 10.1038/nature14436

Haldin CE, LaBonne C. SoxE factors as multifunctional neural crest regulatory factors. Int J Biochem

Cell Biol. 2010; (42):441–4. DOI: 10.1016/j.biocel.2009.11.014

Murko and Bronner

Page 13

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

Hamburger V, Hamilton HL. A series of normal stages in the development of the chick embryo. 1951.

Dev Dyn. 1992; (195):231–72. DOI: 10.1002/aja.1001950404

Hauser C, Schuettengruber B, Bartl S, Lagger G, Seiser C. Activation of the mouse histone deacetylase

1 gene by cooperative histone phosphorylation and acetylation. Mol Cell Biol. 2002; (22):7820–

7830. MCB.22.22.7820-7830.2002. [PubMed: 12391151]

Henrique D, Adam J, Myat A, Chitnis A, Lewis J, Ish-Horowicz D. Expression of a Delta homologue

in prospective neurons in the chick. Nature. 1995; (375):787–90. DOI: 10.1038/375787a0

[PubMed: 7596411]

Herlofsen SR, Hoiby T, Cacchiarelli D, Zhang X, Mikkelsen TS, Brinchmann JE. Brief report:

importance of SOX8 for in vitro chondrogenic differentiation of human mesenchymal stromal

cells. Stem Cells. 2014; (32):1629–35. DOI: 10.1002/stem.1642 [PubMed: 24449344]

Huang YH, Jankowski A, Cheah KS, Prabhakar S, Jauch R. SOXE transcription factors form selective

dimers on non-compact DNA motifs through multifaceted interactions between dimerization and

high-mobility group domains. Sci Rep. 2015; (5):10398.doi: 10.1038/srep10398 [PubMed:

26013289]

Kamachi Y, Kondoh H. Sox proteins: regulators of cell fate specification and differentiation.

Development. 2013; (140):4129–44. DOI: 10.1242/dev.091793 [PubMed: 24086078]

Kim YJ, Lim H, Li Z, Oh Y, Kovlyagina I, Choi IY, Dong X, Lee G. Generation of multipotent

induced neural crest by direct reprogramming of human postnatal fibroblasts with a single

transcription factor. Cell Stem Cell. 2014; (15):497–506. DOI: 10.1016/j.stem.2014.07.013

[PubMed: 25158936]

Le Douarin NM. The ontogeny of the neural crest in avian embryo chimaeras. Nature. 1980; (286):

663–9. [PubMed: 6106161]

Lefebvre V, Li P, de Crombrugghe B. A new long form of Sox5 (L-Sox5), Sox6 and Sox9 are

coexpressed in chondrogenesis and cooperatively activate the type II collagen gene. EMBO J.

1998; (17):5718–33. DOI: 10.1093/emboj/17.19.5718 [PubMed: 9755172]

Lwigale PY, Conrad GW, Bronner-Fraser M. Graded potential of neural crest to form cornea, sensory

neurons and cartilage along the rostrocaudal axis. Development. 2004; (131):1979–91. DOI:

10.1242/dev.01106 [PubMed: 15056619]

McKeown SJ, Lee VM, Bronner-Fraser M, Newgreen DF, Farlie PG. Sox10 overexpression induces

neural crest-like cells from all dorsoventral levels of the neural tube but inhibits differentiation.

Dev Dyn. 2005; (233):430–44. DOI: 10.1002/dvdy.20341 [PubMed: 15768395]

Meulemans D, Bronner-Fraser M. Gene-regulatory interactions in neural crest evolution and

development. Dev Cell. 2004; (7):291–9. DOI: 10.1016/j.devcel.2004.08.007 [PubMed:

15363405]

Nordin K, LaBonne C. Sox5 Is a DNA-binding cofactor for BMP R-Smads that directs target

specificity during patterning of the early ectoderm. Dev Cell. 2014; (31):374–82. DOI: 10.1016/

j.devcel.2014.10.003 [PubMed: 25453832]

Perez-Alcala S, Nieto MA, Barbas JA. LSox5 regulates RhoB expression in the neural tube and

promotes generation of the neural crest. Development. 2004; (131):4455–65. DOI: 10.1242/dev.

01329 [PubMed: 15306568]

Sauka-Spengler T, Barembaum M. Gain- and loss-of-function approaches in the chick embryo.

Methods Cell Biol. 2008; (87):237–56. DOI: 10.1016/S0091-679X(08)00212-4

Sauka-Spengler T, Bronner-Fraser M. A gene regulatory network orchestrates neural crest formation.

Nat Rev Mol Cell Biol. 2008a; (9):557–68. DOI: 10.1038/nrm2428 [PubMed: 18523435]

Sauka-Spengler T, Bronner-Fraser M. Evolution of the neural crest viewed from a gene regulatory

perspective. Genesis. 2008b; (46):673–82. DOI: 10.1002/dvg.20436 [PubMed: 19003930]

Simoes-Costa MS, Bronner ME. Reprogramming of avian crest axial identity and cell fate. Science.

2016 in press.

Simoes-Costa MS, McKeown SJ, Tan-Cabugao J, Sauka-Spengler T, Bronner ME. Dynamic and

differential regulation of stem cell factor FoxD3 in the neural crest is Encrypted in the genome.

PLoS Genet. 2012; (8):e1003142.doi: 10.1371/journal.pgen.1003142 [PubMed: 23284303]

Murko and Bronner

Page 14

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

Simoes-Costa M, Tan-Cabugao J, Antoshechkin I, Sauka-Spengler T, Bronner ME. Transcriptome

analysis reveals novel players in the cranial neural crest gene regulatory network. Genome Res.

2014; (24):281–90. DOI: 10.1101/gr.161182.113 [PubMed: 24389048]

Simoes-Costa M, Bronner ME. Establishing neural crest identity: a gene regulatory recipe.

Development. 2015; (142):242–57. DOI: 10.1242/dev.105445 [PubMed: 25564621]

Szewczyk E, Nayak T, Oakley CE, Edgerton H, Xiong Y, Taheri-Talesh N, Osmani SA, Oakley BR.

Fusion PCR and gene targeting in Aspergillus nidulans. Nat Protoc. 2006; (1):3111–20. DOI:

10.1038/nprot.2006.405 [PubMed: 17406574]

Uchikawa M, Ishida Y, Takemoto T, Kamachi Y, Kondoh H. Functional analysis of chicken Sox2

enhancers highlights an array of diverse regulatory elements that are conserved in mammals. Dev

Cell. 2003; (4):509–19. [PubMed: 12689590]

Wahlbuhl M, Reiprich S, Vogl MR, Bosl MR, Wegner M. Transcription factor Sox10 orchestrates

activity of a neural crest-specific enhancer in the vicinity of its gene. Nucleic Acids Res. 2012;

(40):88–101. DOI: 10.1093/nar/gkr734 [PubMed: 21908409]

Werner T, Hammer A, Wahlbuhl M, Bosl MR, Wegner M. Multiple conserved regulatory elements

with overlapping functions determine Sox10 expression in mouse embryogenesis. Nucleic Acids

Res. 2007; (35):6526–38. DOI: 10.1093/nar/gkm727 [PubMed: 17897962]

Murko and Bronner

Page 15

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

Highlights

•

The chicken Sox10E1 enhancer is active in migrating trunk neural crest and

the otic vesicle

•

Two Sox binding sites are critical for enhancer activity in both tissues

•

Knockdown of Sox8 and Sox5 reduces neural crest specific Sox10E1 reporter

activity

•

Sox5 occupies the Sox10E1 enhancer in the trunk

•

Sox5 and Sox8 can physically interact with each other

Murko and Bronner

Page 16

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

Figure 1. Activity of the Sox10 E1 enhancer

EGFP expression driven under control of the Sox10E1 enhancer fragment in stage HH18

chick embryos (A, C). Endogenous Sox10 expression pattern at the corresponding

developmental stage:

In situ

hybridization to detect Sox10mRNA levels (B) and antibody

staining (D) on electroporated embryos (merge in E). Note that while endogenous Sox10

protein is also expressed in the delaminating NC cells (arrowhead in D), the GFP signal is

only visible in the migratory cells that have detached from the neural tube. Comparison of

Sox10E-GFP (including Sox10E2, F) with Sox10E1-mCherry activity (G) and endogenous

Sox10 expression levels (H,

in situ

) at stage HH12. Sox10E1 is restricted to the otic placode

at that stage and not active in the cranial neural crest (arrowheads in F).

Murko and Bronner

Page 17

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

Figure 2. Sox10E1 sequence conservation and analysis

Output of the ECR genome browser showing the sequence conservation of chicken Sox10E1

throughout different species (A). The element is found on chromosome 1, position

53010774-53011395. Summary of the deletion constructs generated in this study is shown in

(B). Corresponding positions of the mutations are indicated. Conservation across species

was analyzed using the UCSC genome browser (C).Mutated sites are indicated.

Murko and Bronner

Page 18

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

Figure 3. Defining essential regions mediating trunk expression

Serial deletions of the Sox10E1 fragment were tested for their ability to drive GFP

in ovo.

While So10E1Δ1 still drives robust GFP expression in the trunk neural crest (A) and in the

otic vesicle (B), Sox10E1Δ8 has lost trunk neural crest activity (C) while still being active in

the otic vesicle (D). In all cases, the deleted version was coinjected with the full length

Sox10E1mCherry. Merged images are shown.

Murko and Bronner

Page 19

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

Figure 4. Two SOX sites have differential regulatory function

Mutation of a potential SoxD/E binding site (M4) omits expression in the trunk (A), but is

still active in the otic vesicle (B–C). Mutating a putative SoxE binding site (M6) has no

effect on trunk expression (D) but reduces expression in the otic vesicle (E–F). Mutating

both sites completely abolishes expression in both tissues (G–I). In all cases, mutant

constructs are marked by GFP and co electroporated with the wild type version of the

Sox10E1 enhancer tagged with mCherry. C, F and I show representative sections through the

otic vesicle. Merged images are shown. Quantified otic fluorescence for M4 and M6 are

shown in (J). P= 0.06.

Murko and Bronner

Page 20

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript

Figure 5. Expression of Sox5 and Sox8 during stages of Sox10E1 enhancer activity

In situ

hybridization showing expression of Sox5 during vagal and trunk neural crest

migration (AB). Sox5 is strongly expressed in the migratory crest cells streams surrounding

the otic vesicle but not in the otic vesicle itself (A). Later on, it is present in the trunk neural

crest, somites and surrounding mesoderm (B).

In situ

hybridization for

Sox8

shows

expression in the otic vesicle and in the R6 stream at HH13 (C). During trunk neural crest

migration, Sox8 is expressed at lower levels in the migratory crest (D).

Murko and Bronner

Page 21

Dev Biol

. Author manuscript; available in PMC 2018 February 13.

Author Manuscript