Microsoft Word - Kahan et al, Supp SCN_VIP estrous cycle Science 010923.docx

Supplementary materials

Materials and Methods:

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Antibodies

GFP (Chicken); Cleared tissue: 1:200

Aves

GFP-1020,

RRID

AB_1608076

GFP (Goat); brain s

lices: 1:1000

abcam

ab6673

RRID

AB_305643

VIP (Rb); brain slices: 1:500

Immunostar

20077

RRID

AB_572270

c-Fos (Rb); Cleared tissue: 1:

200; brain slices: 1:500

abcam

ab209794

RRID AB_2905616

VPAC2 (Rb) ; brain slices: 1:200

Antibodies.com

A96020 (G790)

RRID AB_10695996

KISS1R (Rb) ; brain slices: 1:40 **

Proteintech

15505-1-AP

RRID

AB_10640578

GnRH (GP) ; brain slices:

1:10000

Greg Anderson, Otago

University

GA-04

Alexa Fluor 488 AffiniPure F(ab'

)2 Fragment Donkey Anti-Chicken

IgY (IgG) (H+L)*

Jackson Immune

703-546-155

RRID

AB_2340376

Alexa Fluor® 647 AffiniPure Fab

Fragment Donkey Anti-Rabbit

IgG (H+L)*

Jackson Immune

711-607-003

RRID

AB_2340626

Cy™3 AffiniPure Donkey Anti-Guinea Pig IgG (H+L)*

Jackson Immune

706-165-148

RRID

AB_2340460

Donkey Anti-Goat IgG H&L (Alexa Fluor® 488)*

abcam

ab150129

RRID

AB_2687506

Bacterial and virus strains

AAV5.hSyn.DIO.hM3D(Gq).mcherry

Addgene

44361-AAV5

AAV5.Flex.taCasp3.TEVp

UNC Vector Core

#45580

AAV5.Ef1a.DIO.eYFP.WPRE.hGH

Addgene

27056-AAV5

AAVrt.CAG.FLEX.tdTomato.WPRE

Addgene

51503-AAVrg

AAVrt.CAG.sgVipr2(A)

Glab

AAVrt.CAG.sgVipr2(B)

Glab

AAVrt.CAG.sgKiss1r

Glab

Chemicals, peptides, and

recombinant proteins

Normal Donkey Serum

Jackson Immune

017-000-121

Dimethyl sulfoxide

Fisher

D128-4

Heparin

Sigma-aldrich

H3393-100KU

Triton X 100

Sigma-aldrich

93443-100ML

TWEEN 20

Sigma-aldrich

3005

Glycine

Sigma-aldrich

G7126-100G

D-Fructose

Sigma-aldrich

F0127-1KG



-Thioglycerol

Sigma-aldrich

M1753-100ML

Clozapine N-oxide (CNO) dihydrochloride



Tocris

6329/10

Recombinant DNA an

d virus perpetra

tion components

pSpCas9(BB)-2A-GFP, Feng Zhang

Addgene

48138

AAV2-retro, Alla Karpova and

David Schaffer

Addgene

81070

Neuro-2a cells

ATCC

CCL-131

HEK293T cells

ATCC

CRL 3216

QuickExtract DNA Extraction Solution

Lucigen

QE09050

NEBuilder HiFi

New England Biolabs

E2621

polyethylenimine

Polysciences

24765-1

Iodixanol, Optiprep

Sigma-Millipore

D1556

Software and algorithms

ICE analysis

Synthego

ImageJ, version 2.0.0-rc-69/1.52n

NIH, open source

https://fiji.sc/

Adobe Illustrator, 24.0.2 (64-bit)

Adobe

https://www.adobe.com/pr

oducts/illustrator.html

Matlab R2020b, R2018a

MathWorks Inc.

https://www.mathworks.co

m/products/matlab.html

Imaris 9.2.0

Oxford Instruments

https://imaris.oxinst.com/

Zen (LSM 880, 2.3 lite)

Zeiss Microscopy

https://www.zeiss.com

BioRender

https://biorender.com/

Custom code to analyze and ge

nerate figures

This paper

GradinaruLab/SCN-VIP-

estrous-cycle: Anat Kahan,

Jan 2023 (github.com)

Other

Optical fiber, 400 μm diameter, 7 mm long

Doric Lenses

MFC_400/430-

0.48_7mm_ZF1.25_FLT

Mono Fiberoptic Patch c

able (fiber photometry)

Doric Lenses

MFC_400/430_0.48_2m_F

C_ZF1.25_FL

Double patch cable (optoge

netics)

Doric Lenses

BFP(2)_400/430/1100_0.4

8_1.5m_FCM*-

2xZF1.25(F)

Table S1: Detailed reag

ent and resources.

* All secondaries were used at 1

:200 for cleared tissue, and 1:

1000 for 70/100



m brain slices

**This ab was incubated for two over-nights in 4°c.

sgRNA crRNA sequence

Forward primer

Reverse primer

Vipr2-B GGGCATCCGAATGACCCACC TTGACTCACCCAGGAAAGCC TTGGAAATGGGCA

GCAGAC

Kiss1r-B AGCGTTGGACGGAGCCCACC CA

GAGGAGCCTCTTTCCAGC TTCCTGACTTGG

ACCCCAGA

Table S2: related to figure 4. crRNA sequences and associated p

rimers for Genetic knockout in GnRH neurons using

CRISPR

Experimental animals

Mice used in this work include C57BL/6NCrl (Charles River), VIP

-IRES-Cre (Jackson Laboratory Stock,

JAX, 010908) crossed to C57BL/6NCrl (Charles River), or Ai162 (

GCaMP6s reporter line, JAX, 031562).

The usage of Ai162 line, when crossed to a Cre line, allows sup

pression of GCaMP6s expression using a

doxycycline diet. Therefore

for fiber photometry recording, the diet was given to the breed

ing pair and the

offspring until 2-4 weeks before surgeries, to prevent toxicity

or developmental issues. For optogenetic

experiments, VIP-IRES-Cre line was crossed to Ai132 (ChR2, JAX,

24109). For GnRH neurons gene

editing, GnRH-Cre line (Gnrh1-Cre, JAX, 21207) was crossed to R

osa26-Cas9 (JAX, 24858). Animals

were group housed (2-4 per group)

whenever possibl

e to ensure a

regular estrous cycle. Mice were single-

housed for FP experiments that required 24/7 recordings and opt

ogenetic experiments. Females that were

single housed for calcium recording received a handful of fresh

male mice bedding every cage change to

ensure regular estrous cycles. Mice had a running wheel or a cl

eared tube for enrichment in their home

cage. For optogenetics, mice were connected with two-branched p

atch cables, so runnin

g wheels/tubes were

impossible. Mice were kept at 12:12 light cycle, unless stated

otherwise. The ambient room light intensity

was 4.49E14 photons/cm

/sec (150 lux). Light at ‘lux’ units was measured with the Ligh

t Meter smartphone

app (‘My mobile Tools Dev’). Light power (mW) was measured with

Thorlabs S120C photodiode. The

energy units were divided by the sensor dimensions, 0.94 cm

. Unit conversion from mW/cm

photons/cm

/sec were calculated using:

푛

௣௛௢௧௢௡௦

∙퐸ൌ푛

௣௛௢௧௢௡௦

∙

௛௖

ఒ

, where

ℎ

is Plank constant, c is the

speed of light, and

휆

is the light wavelength (at maximum). Mice were used until 10

months old to ensure

a regular estrous cycle (

), and were age-matched for each experiment. Animals had

ad libitum

access to

food and water.

FP recording

light manipulation, optogenetic and chemogenetic experiments w

ere performed in rat cages

(40 x 34 cm). For FP, the lid was modified to have a hole in th

e middle for the patch cable.

Light manipulation experiments with PIR detection and/or optoge

netic manipulation were performed in rat

cages, with a 10-inch diameter Plexiglas cylinder, 34 cm in hei

ght, to ensure sufficient PIR detection. Mice

were group housed for light manipulation experiments. For optog

enetic experiments, mice were single-

housed due to the patch cable. Other light manipulation experim

ents (cohort 1 of DREADD, C57) were

performed in regular mice cages.

Animal husbandry and experiment

al procedures involving animal s

ubjects were conducted in compliance

with the Guide for the Care and Use of Laboratory Animals of th

e National Institutes of Health and

approved by the Institutional Animal Care and Use Committee (IA

CUC) and by the Office of Laboratory

Animal Resources at California In

stitute of Technology under IA

CUC protocol 1739. Mice were excluded

from the entire FP experiment i

f there was no dynamic photometr

y signal or no two-photon signal 3 or 5

weeks after surgery, respectively.

Surgery

Stereotactic viral vector injections

were made in mice anesthetized with isoflurane (5% induction,

1–

1.5% maintenance) and placed on a stereotaxic frame (942, David

Kopf Instruments, CA, USA). An

incision was made to expose the

skull, including Bregma, lambda

, and the target sites’ external

coordinates. Stereotaxic coordinates were measured from Bregma

and were based on the Mouse Brain

Atlas (

2, 3

), and improvement was made based on 2D or LiGS histology. A cr

aniotomy hole was drilled

above the target. Virus injecti

on and implantations were perfor

med as follows:

Cell apoptosis:

VIP-Cre mice were injected with AAV5.Flex.taCasp3.TEVP virus (

Experimental, 2.9E12

VG/ml) or AAV5.Ef1a.DIO.eYFP.WPRE

.hGH (control, 2.3E12 VG/ml),

AP -0.3/-0.2 mm, ML ± 1.19

mm, DV -5.75 and -5.6 mm from the brain, left and right sides,

at 13 degrees, 2 x 350 nl each side.

Excitatory DREADD

: VIP-Cre mice were injected with excitatory DREADD or control

virus at the SCN;

AAV5.hSyn.DIO.hM3D(Gq).mcherry (1.0E13 VG/ml) or AAV5.Ef1a.DIO.

eYFP.WPRE.hGH (1.0E13

VG/ml) respectively, AP -0.3/-0.2 mm, ML ± 1.19 mm, DV -5.75 an

d -5.6 mm from the brain, left and

right sides, at 13 degrees, 2 x 300 nl each side.

Genetic ablation in GnRH neurons:

GnRH-Cre x Cas9 mice were injected with AAVrt.U6-sgRNA(SapI)-

CAG-mRuby2-WPRE-hGHpA (1.4E13 VG/ml

) or AAVrt.CAG.flex.tdTomato

(6.4E12 VG/ml, control),

into the median eminence, targeting GnRH processes (

), prepared as described i

n the following section.

AP -1.4 mm, ML ± 0.3 mm, DV -5.65 and -5.4 mm from the brain, l

eft and right sides, at 0 degrees, 2 x

300 nl each side.

All viruses were injected at a rate of ~80 nl/min using a blunt

33-gauge microinjection needle within a 10



l microsyringe (NanoFil, World Precision Instruments, WPI) by a

n UltraMicroPump (UMP3-4, WPI),

controlled by a pump controller (Micro4, WPI)

Fiber photometry (FP), Optogenetics

: Two optical fibers with a cut length of 7 mm and diameter of

400

μm (MFC_400/430-0.48_7mm_ZF1.25_FLT ,NA=0.48, Doric lenses, Can

ada) were firmly mounted to a

stereotaxic holder. Two fibers were implanted to improve the pr

obability of successfully targeting the

structure. A thin layer of Metabond (

Parkel

) was applied to the skull surface to secure the fiber. In addi

tion,

a thick layer of black dental cement (JET denture repair powder

and liquid) was applied to secure the fiber

implant and to prevent interfe

rences between the excitation lig

ht to light-sensitive targets that are not the

SCN.

Extended details about viruses and implants can be found in Tab

le S1.

In some cases, following implant surgery, an ovariectomy (OVX)

was performed as follows:

OVX:

Each mouse was given a single dose of ketoprofen 5 mg/kg SC an

d sustained-release buprenorphine

at 1mg/kg SC. The mouse was then

anesthetized with 1-5% isoflur

ane in an induction box followed by

maintenance in a nose cone and w

as maintained on a heating pad

throughout the surgery. A small dorsal

midline incision was made over the abdomen. The abdominal cavit

y was entered via a blunt puncture

through the abdominal wall. The ovary was dissected. The fat pa

d and tissue were returned to the abdominal

cavity, and the abdominal wall was closed with 4-0 absorbable m

ultifilament suture in an interrupted

pattern. The process was repeated on the opposite side through

a single incision. The skin incision was

closed with surgical wound clips or by suturing with a monofila

ment 4-0 suture material in an interrupted

pattern. Before closure, bupivacai

ne (1 mg/kg of 0.25% solution

) was applied subcutaneously to the wound

margins. Mice received 30mg/kg Ibuprofen

ad lib

(20 mg per 100 ml water) for at least 5 days. For all OVX

females, surgery success was verified by collecting vaginal sme

ars for at least 10 days, showing either

diestrus or metestrus states.

All m

ice were given 1 mg/kg sustained-release buprenorphine and 5 mg

/kg ketoprofen s.c. Intraoperatively

and received 30 mg/kg ibuprofen p.o. in their home cage water f

or at least five days postoperatively for

pain. Mice were allowed a minimum of 14 days for surgical recov

ery before participation in behavioral

studies.

Genetic knockout in GnRH neurons using CRISPR

Guide RNA cloning and validation:

sgRNA sequences were validated

using pSpCas9(BB)-2A-GFP

(PX458; a gift from Feng Zhang, Addgene ID: 48138). Briefly, Ne

uro-2a cells (ATCC CCL-131) were

transfected in duplicate with PX458 containing sgRNAs of intere

st, and their DNA was extracted at 72

hours post-transfection (QuickExtract DNA Extraction Solution,

Lucigen, QE09050). The targeted region

was amplified with PCR, and Sanger sequenced. Reads were analyz

ed for editing efficiency using ICE

analysis (Synthego). Only sgRNA sequences that yielded >70% edi

ting efficiency (roughly corresponding

to the transfection efficiency) were used for

in vivo

experiments. Extended data regarding Recombinant

DNA and virus perpetration components information can be found

in Table S1. crRNA sequences and

associated primers can be found in Table S2.

For

in vivo

sgRNA delivery, pAAV.U6-sgRNA(Sa

pI)-CAG-mRuby2-WPRE-hGHpA was

generated by

inserting a dsDNA fragment containing the U6 promoter and

Streptococcus pyogenes

Cas9 guide RNA

scaffold with SapI sites for crR

NA insertion into MluI-digested

pAAV-CAG-mRuby2 (

), using NEBuilder

HiFi (New England Biolabs, E2621). crRNA sequences were inserte

d by annealing complementary oligos

containing overhangs, followed by ligation into SapI-digested p

AAV.U6-sgRNA(SapI)-CAG-mRuby2-

WPRE-hGHpA.

AAV production:

pAAV.U6-sgRNA-CAG-mRuby2-WPRE-hGHpA containing validated sgRNA

sequences was packaged into AAV2-retro (

) capsids through triple trans

ient transfection of HEK293T

cells (ATCC, CRL 3216) with polye

thylenimine (Polysciences, 247

65-1), followed by cell lysis and

purification over iodixanol (Optiprep; Sigma-Millipore, D1556),

as previously described (

). The AAV2-

retro rep-cap plasmid was a gift from Alla Karpova and David Sc

haffer (Addgene ID: 81070). Viral titers

were obtained through qPCR, using a linearized genome plasmid a

s a standard. Cells were verified to be

free of Mycoplasma contamination prior to AAV production.

Fiber photometry recording

FP is a method for measuring population calcium-dependent fluor

escence from genetically-defined cell

types in deep brain structures using a single optical fiber for

both excitation and emission in freely moving

mice. A detailed description of the system can be found elsewhe

re (

). Briefly, o

ur system employed a

490 nm LED for fluorophore exc

itation (M490F1, Thorlabs; filter

ed with FF02-472/30-25, Semrock) and

a 405 nm LED for isosbestic excitation (M405F1, Thorlabs; filte

red with FF01-400/40-25, Semrock),

which were modulated at 211 Hz and 531 Hz, respectively. Two sy

stems were used for recording, both

controlled by a real-time processor (System 1: RX8-2; System 2:

RZ5P, Tucker-Davis Technologies), and

delivered to the implanted optical fiber via a 0.48 NA, 400 μm

diameter mono-fiber optic patch cable

(MFP_400/430/LWMJ-0.48_2 m_FC-ZF1

.25, Doric Lenses). The emissi

on signal from isosbestic

excitation, which was previously shown to be calcium-independen

t for GCaMP sensors (

9, 10

), was used

as a reference signal to account for motion artifacts and photo

bleaching. Emitted light was collected via

the patch cable, collimated, filtered after passing through a f

ocusing lens (System 1: MF525-39 filter,

Thorlabs, 62–561 focusing lens, Edmunds Optics; System 2: Mini

Cube

FMC6

, Doric Lenses), and

detected by a femtowatt photor

eceiver (Model 2151, Newport). Ph

otoreceiver signals were demodulated

into GCaMP and control (isosbestic) signals, digitized (samplin

g rates: System 1: 382 Hz; System 2: 6

Hz), and low-pass filtered at 25 Hz using a second-order Butter

worth filter with zero phase distortion. A

least-squares linear fit was applie

d to align the 405 nm signal

with the 490 nm signal. Then, the fitted 405

nm signal was subtracted from the 490 nm channel and then divid

ed by the fitted 405 nm signal to

calculate dF/F values.

Behavioral assays

Estrous Cycle Stage Identification:

Estrous cycle stage was recorded

following established protocol

s (

Briefly, vaginal smears (VS) were collected with a 100 or 20



l pipette holding 15



l saline at ZT10-14. In

cases where the room was entered for injections or light stimul

ation, VSs were taken at the time of

interference to reduce entrainments. VS were flattened and allo

wed to dry on a microscope slide (Adhesion

Superfrost Plus Glass Slides, Brain Research Laboratories) and

stained with cresyl violet dye (0.1%, Sigma-

Aldrich, C5042-10G). Smears were then analyzed using light micr

oscopy. Proestrus is characterized by a

high number of nucleated epithelial cells. The estrus stage has

a high number of cornified epithelial cells.

During metestrus there is an in

creased amount of leukocytes, wi

th the presence of cornified epithelial cells

and some nucleated epithelial cells. Diestrus is characterized

by mostly leukocytes, with low presence of

cornified epithelial cells and nuc

leated epithelial cells. We d

efined the number of proestrus events based

on the number of identified proestrous events, even if a full c

ycle was not detected during the monitored

period.

OVX and hormonal replacement:

OVX was verified by having a VS profile of diestrus or metestru

s. At

least four weeks after OVX, sex hormone stimulation was perform

ed as follows; e

stradiol was administered

at 10 μg and progesterone at 500 μg in 0.05 ml of sesame oil de

livery s.c. at ZT8, which has been shown to

induce sexual receptivity. These estradiol levels are comparabl

e to physiological proestrus peak levels (

Locomotor activity (LMA) detection:

Mice were placed in a rat cage (40 X 34 cm). A PIR motion detec

tor

(COMPASS (

)) was placed 35 cm above the cage bottom, and a Plexiglas cyli

nder was placed in the

middle (10-inch diameter) to ensure even detection of mouse act

ivity. Mice were placed with a tube used

for handling to reduce anxiety (

Chemo- and Optogenetics:

After recovery from the surgery, mice were moved to the behavio

ral room with

the light cycle used for the experiment and handled for at leas

t two weeks before the experiment started.

Female mice were placed in a rat cage with a round cylinder, as

described above. Mice were given at least

3-4 days to acclimate to the new cage setup and handling. Follo

wing the first baseline session, the light

cycle was changed to DD, with additional light stimulation at C

T0 (DD +CT0

0.5L

), to preserve their

locomotor rhythm as much as possible. At either CT4 or CT10, st

imulation was given as follows:

For optogenetics: a 447nm laser (MDL-III-447-200mW, OptoEngine

LLC) was used, at 15 Hz, pulse

duration of 15 ms, and an intensity of 10 mW, repeated for one-

hour total. This pattern was adopted from

Mazuski et al. (high frequencies pattern) (

). In addition to the black dental cement, we used two layers

of black heat-shrink tubes to prevent interferences between the

relatively high-intensity laser and light-

sensitive targets, which are not the SCN.

For DREADD: CNO was prepared in distilled water at 1 mg/ml as a

stock solution and kept for up to a

month at -20 °C. CNO was injected i.p. at 0.1 mg/ml, (0.1 ml pe

r 10 gr) for 1 mg/kg.

To validate opto- and chemogenetic activation

post hoc

, we activated the cells for one hour under the same

conditions or injected CNO one hour before mice were sacrificed

(at ZT14) and examined c-Fos and ChR2

or hM3Dq expression using IHC.

During all light and neuronal manipulation studies, vaginal sme

ars (VSs) were taken daily at ~ZT10, except

for opto- and chemogenetic experi

ments, in which VSs were taken

prior to stimulation to prevent further

interference. For these experiments, females were assessed for

three weeks for a regular estrous cycle using

vaginal smears, and their weight was monitored every three week

s. Females with low number of cycles, <3

over three weeks, were removed from the cohort, but left in the

cage for social stability. In one case, a

female was excluded from the expe

riment due to severe weight lo

ss (>10%). For light and SCN

VIP

activation

experiments, females that were not affected by the reduced ligh

t conditions were not considered as

‘rescuable’, and therefore were excluded (6/41).

Released egg collection

: Ovulating eggs were collected from the oviduct the day after

ovulation, within 24-

30h after the detected proestrus state. Cumulus-oocyte complexe

s were isolated in M2 media (Sigma,

M7167) supplemented with 0.3% hyaluronidase (Sigma, H3506) to d

etermine the number of eggs ovulated.

LiGS 3D histology

LiGS tissue preparation:

LiGS histology of implanted mi

ce was performed as described pre

viously (

after perfusion (20 ml 1× PBS followed by 20 ml 4% PFA), the im

plant was kept intact; the skin and the

lower jaw were gently removed. The remaining skull, including b

oth brain and implant, was placed in 4%

PFA for two days. Following fixation, samples were washed in 1

x PBS, then placed in 15% and 30%

sucrose solution for cryoprotection. For LED coupling, samples

were placed in 22x22 mm disposable

embedding molds (70182, EMS) with OCT (Tissue-Tek Compound, Sak

ura Finetek) and were frozen with

an ethanol/dry-ice bath (−78°C)

. The brain was

positioned such

that the optical impla

nt was perpendicular

to the cube during freezing. Next, a 5 mm LED (Chanzon, yellow)

was placed directly above the optical

device and secured with additional OCT. To give the brain–OCT c

ube a flat surface, a 20x40 mm

embedding mold (70184, EMS) was

filled with OCT while the brain

(and coupled LED) was placed upside

down and dipped together into the ethanol/dry-ice bath. This pr

ocess created a large, stable OCT cube that

included the sample and the coupled LED. The sample was then cu

t on one side to expose the LED wires

and stored at −80°C until needed.

Light-guided cryo-sectioning:

Brains in OCT were placed in a cryostat and sliced from the bot

tom in 50–

100um steps with the LED turned on.

To ensure a reproducible li

ght intensity, we used a power supply

(DG1022, RIGOL) set to 2.1 V. We used the profile of the light

spread by manual observation to define the

sectioning endpoint: after the scattered light became sharp, se

ctioning was continued in small steps (20–50



m) until a shaded area was seen i

n the fiber location when the

LED was turned off. After sectioning,

samples were left at room temperature (RT), allowing the OCT to

melt gradually. Samples were then gently

placed in a tube and washed

with 1× PBS solution.

LiGS staining with IHC:

After sectioning, brains were put in 4% PFA for 1–3 hours for

additional fixation.

The staining protocol was adapte

d from the iDisco protocol with

out the pretreatment step [20]. Briefly, the

samples were incubated for two days at 37°C in permeabilization

solution, followed by two days in blocking

solution at 37°C. Next, the samples were incubated with primary

antibodies at a 1:200 concentrations for

5–7 days in PTwH/5%DMSO/3%donkey serum, at 37°C. After washing

at room temperature (RT) until the

next day, samples were incubated with a secondary antibody in P

TwH/3% donkey serum at 37°C for 5–7

days. Lastly, samples were washed

with PTwH at RT until the nex

t day.

LiGS Clearing

: Samples were cleared using the SeeDB protocol at RT (

Thin slice staining:

After perfusion (20 ml 1× PBS followed by 20 ml 4% PFA), brain

sections (70 or 100



m, Leica Vibratome

VT1200S) were first incubated in a blocking buffer solution (1×

PBS solution with 0.1% Triton X-100 and

10% normal donkey serum) for at least one hour, followed by inc

ubation with primary antibodies in the

blocking buffer solution at 4°C overnight. The next day, sectio

ns were thoroughly washed four times in 1×

PBS (15 min each). Next, the brain sections were transferred to

a blocking buffer solution with secondary

antibodies and left overnight at 4°C or for two hours at RT. Ne

xt, sections were washed as described above

and mounted on glass microscope slides (Adhesion Superfrost Plu

s Glass Slides, Brain Research

Laboratories). After the sections were completely dry, they wer

e cover-slipped after applying mounting

media (VECTASHIELD® PLUS).

Extended information about IHC

materials can be found in Table

S1.

Histological imaging

Histological images were obtained with Zeiss 880 confocal micro

scope at 10X and 40X objectives. Images

were analyzed in ImageJ, Matlab, and/or Imaris (Bitplane). Cell

identification of GnRH neurons in the

MPA was performed with the “Spots” function in Imaris (9.8.0 an

d 9.9.1), with a diameter of 15



m, for

each channel separately. In addition, the “Statistics” toolbox

of Imaris was used to identify overlapped

populations (<10



m). For each animal, three brain slices which included the MPA

were quantified, and

the injection quality was validat

ed by observing the injection

site (Figure S6).

Data analysis

Light detection

LMA:

Following PIR motion detection, the mean activity and onset wer

e calculated using an angular

presentation of each 24-hour period, using the “CircStat” toolb

ox for circular statistics (Matlab (

)). Slopes

were calculated using a linear regression function, looking at

the mean activity or onset values over days

(Matlab, with 95% confidence

Fiber photometry (FT):

dF/F was first aligned using the 405 nm channel, as previously

used [30]. When z-

scored data was presented, we used:

푑퐹 퐹

⁄

ൌ퐹െ푚푒푑푖푎푛

ሺ

퐹

௕

ሻ

푚푎푑

⁄ሺ

퐹

ሻ

(where ‘mad’ is the median

absolute deviation, and

퐹

௕

is the background signal during the dark phase). The event rat

e was calculated

using the peak finder algorithm (“findpeaks” using “Annotate,”

Matlab), with a threshold of 1.2 std above

the mean value at the baseline period for the 10 minutes/h sess

ions, and 0.4 for the ZT10-13 recording,

justified by the reduced ability of ‘event rate’ analysis to id

entify low amplitude frequencies, shown by the

FFT classification analysis. For 10 minutes/h sessions, data wa

s collected starting at ZT8 for 24h. For the

analysis, data were shifted by -8 hours. That way, the estrous

cycle definition was accurate for the last 8

hours of the light phase, followed by the rest of the light pha

se and the following dark phase. In the case of

proestrus, ovulation occurs during the dark phase, and the foll

owing light phase should be considered as

estrus. For male-to-female comparison, female data was taken fo

r the proestrus day.

FT FFT analysis

: For each dF/F signal (10 minutes/h), FFT was calculated (‘fft

’, Matlab). For each hour,

integrated FFT power values were calculated for one set of freq

uency intervals: [0.0033 0.007; 0.007 0.05;

0.05 0.1; 0.1 0.25; 0.25 0.45; 0.45 1.0; 1.0 1.35] Hz. The lowe

r limit was set to 0.0005 for the ZT10-13

recording, due to the longer time frame. FFT autocorrelations w

ere calculated for each FFT power interval

over the coarse frequency intervals (set (a),‘autocorr’, Matlab

). See Figure S3 for an example of the FFT

approach on synthesized data.

For classification, a spectrogram of the fine frequency interva

ls was prepared for each session. Each session

was tagged by sex and by hormonal state. Prior to machine learn

ing, the spectrogram dimensions were

reduced by (1) choosing only frequency ranges between 0.003 to

1 Hz (the first six inte

rvals), (2) applying

PCA (pca, ‘Matlab’), i.e. 24 h x 6 frequencies intervals were r

educed from 144 to 12, (3) when indicated,

only a subset of the recording 10-minute intervals were used. A

leave-one-out cross-validation (LOOCV)

approach was used: in each step, one session was left out to be

the ‘testing-set’, while the rest of the sessions

were used as a ‘training-set’, after randomly choosing the same

number of sessions for each state. For

training, we used either a “s

upport vector machine” (SVM, ‘fitc

ecoc’, Matlab), or a “discriminant analysis”

(‘fitcdiscr’, Matlab) classifier, followed by prediction (‘pred

ict’ Matlab). In each classification, the

prediction rate was calculated for the ability to predict each

of the two states, averaged over 5 (24h dataset)

or 10 cycles (ZT10-13 dataset), and the score was plotted as a

matrix, weighted by color (‘matvisual‘,

Matlab, created by Hristo Zhivomirov). SEM between cycles was 1

% on average.

Extended information about Soft

ware and algorithms can be found

in Table S1.

Figure S1, related to Figure 2

FP activity of SCN

VIP

neuron at the transition from light to dark (ZT11-13)

showing sex differences at event rates, but not at the transiti

on from dark to light (ZT23.5 to 0.5).

(A) SCN

VIP

FP activity at ZT11-13 (i) Representative examples of FP record

ings from a female (red) and male (blue) with peak

identification (blue triangles). (ii) Averaged responses (mean±

sem, sem in gray. females: n=14, males: n=5, averaged

for at least three repeats each).

(iii-iv) Mean dF/F and event

rates, compared between male

s and females at ZT 11-12

and ZT 12-13 (mean±sem, with individual values shown). Event ra

tes were higher during the light phase from ZT 11-

12 compared to ZT 12-13 in females but not in males (0.58±0.06

and 0.64±0.05 events/min at ZT11-12 vs. 0.31±0.04

and 0.32±0.04 at ZT12-13, There was no significant difference i

n mean dF/F (3.1±0.1 and 2.69±0.08 a.u. at ZT11-12

vs. 2.9±0.2 and 2.47±0.09 a.u. a

t ZT12-13, males and females, r

espectively. (B) SCN

VIP

FP activity at ZT23.5-0.5. (i)

Averaged responses (mean±sem, sem in gray, females: n = 7, male

s: n = 5, averaged for at least three repeats each).

(ii) Mean dF/F, showing no diffe

rences between males and female

s and a significant increase from dark to light. (iii)

Event rates show no differences between males and females and s

ignificantly increase from dark to light.

Nonparametric Kruskal-Wallis test, * p <0.05.

Figure S2, related to Figure 2: Circadian changes in SCN

VIP

signal are sex-dependent but not estrous-cycle

dependent.

(A) Representative examples of 10

-minute-per-hour recording, ov

er 24 hours, from a female (left) and a

male (right) mouse. (B) DF/F (top) and event rates (bottom) ove

r 24h of recording (p values compare females, n=6

(red) vs. males, n=6 (blue), at least 3 repeats each. (C) Compa

rison of median dF/F (top) and median event rate

(bottom) between males and females over the dark and light phas

es. (D) DF/F over 24h of recording across estrous

states (n=8, each state is represented at least three times in

each female). (E) DF/F averaged over dark and light phases.

For clarity, significance is ma

rked only between adjacent perio

ds. (F) Parabolic fits to median dF/F along ZT2-11.

(G) Averaged event rates over two hours at different points dur

ing the day, showing no significant differences between

estrous states. Data was assigned

relative to the proestrus day

, therefor M/D states were identified either one or two

days before proestrus (M/D P-2 and M/D P-1), as well as two day

s after proestrus, which were either E or M.

Nonparametric Kruskal-Wallis test, followed by Tukey's correcti

on when multi-comparison was done (*p<0.05;

**<0.01; # < 0.005).

Figure S3, related to Figure 2: FFT spectrogram creation approa

ch using artificial data.

(A) Artificial FP data

is a combination of two sine signals, for ZT0-11 and ZT12-23 se

parately, at frequencies of 0.016 and 1.5Hz, with

amplitudes of 10 and 1, as well as 0.02 and 1.0 Hz, with amplit

udes of 1 and 0.2, respectively. (B) FP artificial

oscillations. (C) Power spectra of the artificial FT data (‘fft

’, Matlab), using regular (top) and logarithmic (bottom)

scales. Red dots indicate the c

ontributing frequencies, 0.016,

0.02, 1.0, and 1.5 Hz. (D) Integrated FFT over different

frequency intervals.

Figure S4, related to Figure 3: Cross-validated accuracy with “

Discriminate analysis” algorithm,

using the full

24h FFT spectrograms (left) or

ZT9-11 (right). The accuracy val

ues show similar prediction abilities to the SVM

algorithm.

Figure S5, related to Figure 3. Activity analysis of ZT10-13 FP

data, including OVX induction with sex

hormones

. (A) Averaged dF/F at ZT10-13 a

cross estrous states. (B) Quant

ified dF/F (top) and event rates (bottom),

including OVX induction with sex hormones. *p<0.05; Kruskal–Wal

lis test, Tukey's correction for multi-

comparisons.

Figure S6, related to Figure 4.

Validation of GnRH-Cre x cas9 inj

ection site and VPAC2 antibody

and estrous

state distributions

. (A) The injection site, the median eminence (ME). (B) VPAC2 A

b validation based on expression

in the SCN. (C) Estrous states distributions over three weeks,

before and after injection, control (Ctrl, n=5), sgVipr2

(n=4), and sgKiss1r (Exp, n=6).

Figure S7, related to Figure 5

LMA under different lig

ht conditions of VIP-cre female mice

. (A) LMA under

each light condition of one of th

e cages. Gray asterisks indica

te VS collection time window. For DD condition, ambient

red light was turned on for 10 minutes. (B) Daily onset (left)

averaged (middle) LAM (n cages= 2), presented over

days. Each cage had three females and a running wheel for enric

hment.

Figure S8, relate to Figure 5. The

estrous-state distributions

SCN

VIP

chemogenetic acti

vation experiment.

(A) The experimental design (sam

e as Figure 5).

(B) Estrous sta

tes distributions over three weeks, control (Ctrl, n=6)

and experimental (Exp, n=7).

Figure S9, related to Figure 5. SCN

VIP

optogenetic activation in the l

ate afternoon is insufficient t

o rescue

estrous cycle regularity.

(A-B) Time-restricted SCN

VIP

neurons activation with ChR2. (A) The experimental design.

VIP-Cre females crossed to ChR2 (ctrl: n=5, 447 nm excitation:

n=8) or GFP reporter lines (n=3), put under three

conditions, LD, DD+CT0

+CT4

opto

(447nm excitation at CT4) and DD+CT0

+CT10

opto

(447 nm excitation at CT10,

blue, CT0

is light for 0.5h at CT0). (B) The number of estrous cycles in

three weeks, under the three conditions

shown in D. (C) Detailed LiGS histology of SCN

VIP

neurons below the optical impla

nt. Examples of LiGS histology

for

post hoc

fiber location verification and

c-Fos expression. (i) VIP-Cre

x ChR2 mouse with no neuronal activation.

(ii) VIP-Cre x ChR2 mouse with n

euronal activation, showing c-F

os expression ~1h after illumination with 447 nm

laser, at 3D (top) and 2D (bottom). (iii) VIP-Cre x GFP mouse w

ith c-Fos. Illustration of the fiber in gray, ChR2 or

GFP signal, indicative of VIP neurons in green, c-Fos staining

~1h after illumination with 447 nm laser (magenta),

showing no expression. 447nm laser illumination was done around

ZT14 for 1h.

1. T. Goto, K. Miyamichi, Dynamics of Pulsatile Activities of A

rcuate Kisspeptin Neurons in Aging

Female Mice.

bioRxiv

, 2022.2008.2008.503241 (2022).

2. A. Cetin, S. Komai, M. Eliava, P. H. Seeburg, P. Osten, Ster

eotaxic gene delivery in the rodent brain.

Nature Protocols

, 3166‐3173 (2006).

3. G. Paxinos, K. B. J. Franklin,

The Mouse Brain in Stereotaxic Coordinates

. (Harvard, 2004).

4. P. Campos, A. E. Herbison, Op

togenetic activation of GnRH ne

urons reveals minimal requirements

for pulsatile luteinizing hormone secretion.

Proceedings of the National Academy of Sciences

111

18387‐18392 (2014).

5. K. Y. Chan

et al.

, Engineered AAVs for efficient noninvasive gene delivery to th

e central and

peripheral nervous systems.

Nature Neuroscience

, 1172‐1179 (2017).

6. D. Gowanlock R. Tervo

et al.

, A Designer AAV Variant Permits Efficient Retrograde Access to

Projection Neurons.

Neuron

, 372‐382 (2016).

7. R. C. Challis

et al.

, Systemic AAV vectors for widespread and targeted gene deliver

y in rodents.

Nature Protocols

, 379‐414 (2019).

8. J. R. Cho

et al.

, Dorsal Raphe Dopamine Neurons

Modulate Arousal and Promote Wa

kefulness by

Salient Stimuli.

Neuron

, 1205‐1219.e1208 (2017).

9. Talia N. Lerner

et al.

, Intact‐Brain Analyses Reveal Distinct Information Carried by

SNc Dopamine

Subcircuits.

Cell

162

, 635‐647 (2015).

10. C. K. Kim

et al.

, Simultaneous fast measurement

of circuit dynamics at multiple

sites across the

mammalian brain.

Nature Methods

, 325‐328 (2016).

11. A. C. McLean, N. Valenzuela,

S. Fai, S. A. L. Bennett, Perf

orming Vaginal Lavage, Crystal Violet

Staining, and Vaginal Cytological Evaluation for Mouse Estrous

Cycle Staging Identification. e4389

(2012).

12. J. A. McHenry

et al.

, Hormonal gain control of a med

ial preoptic area social reward

circuit.

Nat

Neurosci

, 449‐458 (2017).

13. L. Brown, S. Hasan, R. Foster, S. Peirson,

COMPASS: Continuous Open Mouse Phenotyping of

Activity and Sleep Status [version 1; referees: 3 approved, 1 a

pproved with reservations]

. (2016),

vol. 1.

14. K. Gouveia, J. L. Hurst, Improving the practicality of usin

g non‐aversive handling methods to

reduce background stress and anxiety in laboratory mice.

Scientific Reports

, 20305 (2019).

15. C. Mazuski

et al.

, Entrainment of Circadian Rhythms Depends on Firing Rates and

Neuropeptide

Release of VIP SCN Neurons.

Neuron

, 555‐563.e555 (2018).

16. A. Kahan

et al.

, Light‐guided sectioning for precise

in situ

localization and tissu

e interface analysis

for brain‐implanted optical fibers and GRIN lenses.

Cell Reports

, (2021).

17. M.‐T. Ke, S. Fujimoto, T. Imai, SeeDB: a simple and morphol

ogy‐preserving optical clearing agent

for neuronal circuit reconstruction.

, 1154 (2013).

18. P. Berens. (MATLAB Ce

ntral File Exchange, 2022).